We narrowed to 8,570 results for: reporter
-
Plasmid#201106Purposeexpression of human FGFR1 receptor tyrosine kinase in mammalian cellsDepositorInserthuman FGFR1 receptor tyrosine kinase, variant c, full length, wildtype (FGFR1 Human)
TagsV5/HisExpressionMammalianPromoterCMVAvailable SinceJune 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
ER-mit RspA-splitFAST (lentiviral plasmid)
Plasmid#233604PurposeExpression of ER-mit RspA-splitFAST by a single lentiviral plasmid encoding the two fragmentsDepositorInsertRspA-splitFAST
UseLentiviralPromoterCMV/SV40Available SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-32a(+)-TGFB1
Plasmid#120361PurposeProduce human recombinant TGFB1 in DE3 cellsDepositorInsertTransforming Growth Factor-β1 (TGFB1 Synthetic, Human)
Tags6x His and S-TagExpressionBacterialMutationCodon optimized for E. Coli productionPromoterT7 PromoterAvailable SinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1-E-'No'Mi-Red-T2A-Puro
Plasmid#246642PurposeEF-1alpha driven EV reporter E-'No'Mi-R, a re-engineered tetraspanin scaffold tagged with bioluminescent and fluorescent reporter proteins. Nanoluc and Flag tag are removable with TEVp.DepositorInsertcleavable E-NoMi-Red
UseLentiviralTagsFLAG-Nanoluciferase and mCherryExpressionMammalianPromoterEF-1alphaAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pF4Ag NanoLuc (ATG-42)
Plasmid#137777PurposeExpresses NanoLuc in multi promoter expression vector (CMV andT7 promoters)DepositorInsertNanoLuc (Nluc)
ExpressionBacterial and MammalianMutationNanoLuc contains 16 amino acid changes compared t…PromoterT7 and CMVAvailable SinceMarch 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGAPTrap-eGFP-IRESMuro
Plasmid#82504PurposeVector targeting the eGFP gene to the GAPDH locus of human cells. eGFP is expressed from a 2A sequence at the C terminus of GAPDH. Puromycin resistance is encoded by the Muro gene.DepositorInserteGFP-IRESMuro
UseSynthetic BiologyExpressionMammalianAvailable SinceSept. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET-32a(+)-TGFB3
Plasmid#120288PurposeProduce human recombinant TGFB3 in DE3 cellsDepositorInsertTransforming Growth Factor-β3 (TGFB3 Synthetic, Human)
Tags6x His and S-TagExpressionBacterialMutationCodon optimized for E. Coli productionPromoterT7 promoterAvailable SinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-TRE3G-NFIA+SOX9
Plasmid#129455PurposeInducible overexpression of NFIA and Sox9 in human cells.DepositorAvailable SinceMarch 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-ERBB2-V5/HIS
Plasmid#201103Purposeexpression of human ERBB2 receptor tyrosine kinase in mammalian cellsDepositorInserthuman ERBB2 receptor tyrosine kinase, full length, wildtype (ERBB2 Human)
TagsV5/HisExpressionMammalianPromoterCMVAvailable SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
ptdTHC
Plasmid#112617Purposepromoterless expression plasmid driving multicistronic cassette H2BtdTomato_p2A_HygroR_p2A_CreERt2DepositorInsertsUsePromoterless vector, ready for promoter for mamma…TagstdTomatoExpressionMammalianPromoterNo PromoterAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-ERBB3-V5/HIS
Plasmid#201104Purposeexpression of human ERBB3 receptor tyrosine kinase in mammalian cellsDepositorInserthuman ERBB3 receptor tyrosine kinase, full length, wildtype (ERBB3 Human)
TagsV5/HisExpressionMammalianPromoterCMVAvailable SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMVtrunc Affimer6-sfCherry2ΔN12
Plasmid#231551PurposeMammalian expression of actin-binding Affimer6 fused to N-terminally truncated superfolder Cherry2, for actin filament organization measurements using fluorescence polarization microscopyDepositorInsertAffimer6
TagssfCherry2ExpressionMammalianPromoterCMVtruncAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-Actin-Vhh-sfGFP-P2A-1xHA-tdiRFP-caax (JDW 1311)
Plasmid#224497PurposeGateway compatible middle entry clone containing an Actin nanobody fused to sfGFP followed by P2A and tdiRFP-caax tag (GFP actin reporter and cell membrane iRFP reporter)DepositorInsertActin-Vhh-sfGFP-P2A-HA-tdiRFP-caax
UseGateway cloningAvailable SinceOct. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEHC_PGKneoLox2DTA.2
Plasmid#112623PurposeH2BEmerald_p2A_HygroR_p2A_CreERt2 targeting plasmid with cloning sites ready for homology armsDepositorInsertsUseCre/Lox and Mouse TargetingTagsEmeraldPromoterNo PromoterAvailable SinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-DDR1-F866Y-V5/HIS
Plasmid#236009Purposeexpression of the F866Y kinase defective mutant variant of human DDR1 that might be associated with lung AdenocarcinomaDepositorInserthuman DDR1-F866Y receptor tyrosine kinase, full length (DDR1 Human)
TagsV5/HisExpressionMammalianMutationF866Y substitutionPromoterCMVAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-28a(+)-FGF2-K128N
Plasmid#120284PurposeProduce human recombinant FGF2 K128N in DE3 cellsDepositorInsertBasic fibroblast growth factor 2 (FGF2 Synthetic, Human)
Tags6x HisExpressionBacterialMutationCodon optimized for E. Coli productionPromoterT7 promoterAvailable SinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-49: MYL2-mEGFP
Plasmid#114414PurposeHomology arms and linker-mEGFP sequence for C-terminus tagging of human MYL2, via Cas9-excisable CAGGS-mCherry selection cassetteDepositorInsertMYL2 Homology Arms with linker-mEGFP and Cas9-excisable selection cassette (MYL2 Human)
UseCRISPR; Donor templateTagslinker-mEGFPExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMVtrunc Affimer6-msfGFPΔN12
Plasmid#231550PurposeMammalian expression of actin-binding Affimer6 fused to N-terminally truncated monomeric superfolder GFP, for actin filament organization measurements using fluorescence polarization microscopyDepositorInsertAffimer6
TagsmsfGFPExpressionMammalianPromoterCMVtruncAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-46: MYL7-mEGFP
Plasmid#114413PurposeHomology arms and linker-mEGFP sequence for C-terminus tagging of human MYL7, via Cas9-excisable CAGGS-mCherry selection cassetteDepositorInsertMYL7 Homology Arms with linker-mEGFP and Cas9-excisable selection cassette (MYL7 Human)
UseCRISPR; Donor templateTagslinker-mEGFPExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
A3Bi-ctd-Cas9n-UGI-NLS
Plasmid#109426PurposeExpresses the C-terminal catalytic domain of human APOBEC3B containing an L1 intron fused to Cas9n, Uracil DNA Glycosylase Inhibitor, with a nuclear localization signal.DepositorInsertApolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-like 3B C-terminal domain (APOBEC3B Human)
UseCRISPRExpressionMammalianMutationInsertion of an L1 intron into the coding sequenc…PromoterCMVAvailable SinceJuly 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGAPTrap-mtagBFP2-IRESMuro
Plasmid#82335PurposeVector targeting the mtagBFP2 gene to the GAPDH locus of human cells. BFP is expressed from a 2A sequence at the C terminus of GAPDH. Puromycin resistance is encoded by the Muro gene.DepositorInsertmtagBFP2-IRESMuro
UseSynthetic BiologyExpressionMammalianAvailable SinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCAG-tdTHC
Plasmid#112621Purposeexpression plasmid with CAG promoter driving multicistronic cassette H2BtdTomato_p2A_HygroR_p2A_CreERt2DepositorInsertsUseCre/LoxTagstdTomatoExpressionMammalianPromoterCAGAvailable SinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
ptdTHC_PGKneoLox2DTA.2
Plasmid#112625PurposeH2BtdTomato_p2A_HygroR_p2A_CreERt2 targeting plasmid with cloning sites ready for homology armsDepositorInsertsUseCre/Lox and Mouse TargetingTagstdTomatoPromoterNo PromoterAvailable SinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGAPTrap-mCherry-IRESMygro
Plasmid#82505PurposeVector targeting the mCherry gene to the GAPDH locus of human cells. mCherry is expressed from a 2A sequence at the C terminus of GAPDH. Hygromycin B resistance is encoded by the Mygro gene.DepositorInsertmCherry-IRESMygro
UseSynthetic BiologyExpressionMammalianAvailable SinceSept. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPBCAG-rtTAM2-2A-SOX17-GR-IH
Plasmid#165079PurposeUbiquitously expresses rtTAM2, dexamethasone-inducible human SOX17, and hygromycin-resistance gene.DepositorInsertsUsePiggybac transpositionTagsGlucocorticoid ReceptorExpressionMammalianAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-VHC
Plasmid#112618Purposeexpression plasmid with CAG promoter driving multicistronic cassette H2BVenus_p2A_HygroR_p2A_CreERt2DepositorInsertsTagsVenusExpressionMammalianPromoterCAGAvailable SinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGAPTrap-eGFP-IRESMygro
Plasmid#82503PurposeVector targeting the eGFP gene to the GAPDH locus of human cells. eGFP is expressed from a 2A sequence at the C terminus of GAPDH. Hygromycin B resistance is encoded by the Mygro gene.DepositorInserteGFP-IRESMygro
UseSynthetic BiologyExpressionMammalianAvailable SinceOct. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mTHC
Plasmid#112620Purposeexpression plasmid with CAG promoter driving multicistronic cassette H2BmTeal_p2A_HygroR_p2A_CreERt2DepositorInsertsTagsmTeal (mTFP1)ExpressionMammalianPromoterCAGAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pVHC_PGKneoLox2DTA.2
Plasmid#112622PurposeH2BVenus_p2A_HygroR_p2A_CreERt2 targeting plasmid with cloning sites ready for homology armsDepositorInsertsUseCre/Lox and Mouse TargetingTagsVenusPromoterNo PromoterAvailable SinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
A3Ai E72A-Cas9n-UGI-NLS
Plasmid#109430PurposeExpresses catalytically inactive human APOBEC3A with an L1 intron fused to Cas9n, Uracil DNA Glycosylase Inhibitor, with a nuclear localization signal.DepositorInsertApolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-Like 3A E72A Catalytic Mutant (APOBEC3A Human)
UseCRISPRExpressionMammalianMutationInsertion of an L1 intron into the coding sequenc…PromoterCMVAvailable SinceJuly 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHL-EF1a-SphcCas9(D10A)-iP-A
Plasmid#60600PurposeExpresses D10A mutant (nickase) of human codon-optimized Cas9 (derived from Streptococcus pyogenes) and pruomycin resistance gene.DepositorInsertsCRISPR Cas9 D10A
puromycin resistance gene
UseCRISPRExpressionMammalianMutationChanged Asp 10 to Ala, Codon usage optimized for …Available SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGAPTrap-IRESMuro
Plasmid#82336PurposeBase vector targeting genes to the GAPDH locus of human cells. Inserted genes are expressed from a 2A sequence at the C terminus of GAPDH. Puromycin resistance is encoded by the Muro gene.DepositorInsertIRESMuro
UseSynthetic BiologyExpressionMammalianAvailable SinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pVHC
Plasmid#112614Purposepromoterless expression plasmid driving multicistronic cassette H2BVenus_p2A_HygroR_p2A_CreERt2DepositorInsertsUsePromoterless vector, ready for promoter for mamma…TagsVenusExpressionMammalianPromoterNo PromoterAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGAPTrap-mtagtdTom_IRESMuro
Plasmid#82355PurposeVector targeting the mTagtandem tomato gene to the GAPDH locus of human cells. It is expressed from a 2A sequence at the C terminus of GAPDH. Puromycin resistance is encoded by the Muro gene.DepositorInsertmtagTandemTomato-IRESMuro
UseSynthetic BiologyExpressionMammalianAvailable SinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGAPTrap-Luc2-IRESMeo
Plasmid#82509PurposeVector targeting the Firefly Luciferase (Luc2) gene to the GAPDH locus of human cells. It is expressed from a 2A sequence at the C terminus of GAPDH. Puromycin resistance is encoded by the Meo gene.DepositorInsertLuc2-IRESMeo
UseSynthetic BiologyExpressionMammalianAvailable SinceSept. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCAG-EHC
Plasmid#112619Purposeexpression plasmid with CAG promoter driving multicistronic cassette H2BEmerald_p2A_HygroR_p2A_CreERt2DepositorInsertsTagsVenusExpressionMammalianPromoterCAGAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEHC
Plasmid#112615Purposepromoterless expression plasmid driving multicistronic cassette H2BEmerald_p2A_HygroR_p2A_CreERt2DepositorInsertsUsePromoterless vector, ready for promoter for mamma…TagsEmeraldExpressionMammalianPromoterNo PromoterAvailable SinceOct. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pmTHC
Plasmid#112616Purposepromoterless expression plasmid driving multicistronic cassette H2BmTeal_p2A_HygroR_p2A_CreERt2DepositorInsertsUsePromoterless vector, ready for promoter for mamma…TagsmTeal (mTFP1)ExpressionMammalianPromoterNo PromoterAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGAPTrap-LacZ-IRESMuro
Plasmid#82507PurposeVector targeting the LacZ gene to the GAPDH locus of human cells. LacZ is expressed from a 2A sequence at the C terminus of GAPDH. Puromycin resistance is encoded by the Muro gene.DepositorInsertLacZ-IRESMuro
UseSynthetic BiologyExpressionMammalianAvailable SinceSept. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-(sgRNA-T2)-Chimeric_BB-CBh-hSpCas9
Plasmid#223323PurposeHuman codon optimized Cas9 expressing plasmid that carries the sgRNA T2 from Mali et al., 2013 (10.1126/science.1232033).DepositorInsertSpCas9 and sgRNA-T2 (cas9 )
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterU6Available SinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pME-Actin-Vhh-sfGFP-P2A-1xHA-iRFP-caax (JDW 1216)
Plasmid#224496PurposeGateway compatible middle entry clone containing an Actin nanobody fused to sfGFP followed by P2A and iRFP-caax tag (GFP actin reporter and cell membrane iRFP reporter)DepositorInsertActin-Vhh-sfGFP-P2A-HA-iRFP-caax
UseGateway cloningAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-HaloTag-KRas4B(CT)
Plasmid#214276PurposeMammalian expression of HaloTag fused to the C-terminal tail of KRas4BDepositorAvailable SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHES7-NLuc-2A-tdTomato
Plasmid#204348PurposeDonor vector to tag endogenous pig HES7 locusDepositorInsertNLuc-2A-tdTomato
TagsNanoLuc and tdTomatoExpressionMammalianAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
GG-EBNA-MIR302-3g-EEA-2g-PGK-Puro
Plasmid#201677PurposeEBNA episome plasmid for U6 promoter-driven expression of 3 gRNAs targeting miRNA302/367 (Addgene #201960) and 2 gRNAs targeting EEA-motif (Addgene #102898). Includes PGK-puro selection cassetteDepositorInsertMIR302-3g-EEA-2g-PGK-Puro
UseCRISPRExpressionMammalianPromoterU6Available SinceJune 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pmTHC_PGKneoLox2DTA.2
Plasmid#112624PurposeH2BmTeal_p2A_HygroR_p2A_CreERt2 targeting plasmid with cloning sites ready for homology armsDepositorInsertsUseCre/Lox and Mouse TargetingTagsmTeal (mTFP1)PromoterNo PromoterAvailable SinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGAPTrap-Clover-Muro
Plasmid#82334PurposeVector targeting the Clover gene to the GAPDH locus of human cells. Clover is expressed from a 2A sequence at the C terminus of GAPDH. Puromycin resistance is encoded by the Muro gene.DepositorInsertClover-T2AMuro
UseSynthetic BiologyExpressionMammalianAvailable SinceOct. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGAPTrap-eGFP-IRESMeo
Plasmid#82502PurposeVector targeting the eGFP gene to the GAPDH locus of human cells. eGFP is expressed from a 2A sequence at the C terminus of GAPDH. G418 resistance is encoded by the Meo gene.DepositorInserteGFP-IRESMeo
UseSynthetic BiologyExpressionMammalianAvailable SinceSept. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGL4 [luc2P/STAT4-RE/Hygro] Vector
Plasmid#236820PurposeExpress STAT4 response element in luciferase reporter assayDepositorAvailable SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pNL [NlucP/TCF/LEF-RE/Hygro] Vector
Plasmid#236824PurposeExpress LEF response element in luciferase reporter assayDepositorHas ServiceDNAInsertLEF
UseLuciferaseTagsNanoLuc (R)MutationNonePromoterminPAvailable SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits