We narrowed to 27,048 results for: STI
-
Plasmid#103335PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-202-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-202-5p target (MIR202 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-190a-3p
Plasmid#103297PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-190a-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-190a-3p target (MIR190A Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-1307-5p
Plasmid#103215PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-1307-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-1307-5p target (MIR1307 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-1287-3p
Plasmid#103203PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-1287-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-1287-3p target (MIR1287 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-1287-5p
Plasmid#103204PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-1287-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-1287-5p target (MIR1287 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-1185-1-3p
Plasmid#103180PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-1185-1-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-1185-1-3p target (MIR1185-1 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-1185-2-3p
Plasmid#103181PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-1185-2-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-1185-2-3p target (MIR1185-2 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-10a-5p
Plasmid#103177PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-10a-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-10a-5p target (MIR10A Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-10b-3p
Plasmid#103178PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-10b-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-10b-3p target (MIR10B Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-10b-5p
Plasmid#103179PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-10b-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-10b-5p target (MIR10B Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
CA-RIT-NFAT1 (IRES-GFP)
Plasmid#85181PurposeConstitutively active NFAT1, mutated to interfere selectively with the NFAT:AP-1 interaction. Co-expresses EGFP for selectionDepositorInsertCA-RIT-NFAT1 (Nfatc2 Mouse)
UseRetroviralTagsHAExpressionMammalianMutationAmino acids 1-3 removed; CA: PASSGSSASF mutated t…Available SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAG-2dV-Camui (wt)
Plasmid#220366PurposeImproved FLIM sensor for CaMK2-alpha activation (mammalian expression, cytosol)DepositorInsertmVenus(Y145W)-mVenus(Y145W)-rat CaMK2 alpha(wt)-mEGFP(A206K) (Camk2a Synthetic, Rat)
TagsmEGFP(A206K) and mVenus(Y145W)-mVenus(Y145W)ExpressionMammalianPromoterCAGAvailable SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-SOUL-P2A-tdTomato
Plasmid#153019PurposeStep-function opsin with ultra-high light sensitivity (SOUL). Capable to be used for noninvasive stimulation in mice and minimally invasive stimulation in macaque.DepositorInsertSOUL
UseAAVTagsP2A-tdTomatoExpressionMammalianMutationC128S/D156A/T159CAvailable SinceJune 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-myc-ERK2-L4A-MEK1_fusion
Plasmid#39197DepositorTagsMycExpressionMammalianMutationL4A = L33A, L37A, L40A, L42APromoterCMVAvailable SinceJuly 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
FUW-TetO-lox-ERAS
Plasmid#52417PurposeDoxycycline inducible lentiviral vector of human ERAS cDNA with excisable insertDepositorInsertERAS (ERAS Human)
UseLentiviralAvailable SinceSept. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSLIK CA MLCK
Plasmid#84647PurposeLentiviral expression of doxycycline-inducible constitutively active MLCK and co-expression of VenusDepositorAvailable SinceDec. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hdAsCas12a(D908A)-NLS(nucleoplasmin)-gs-3xHA-gs-VPR (RTW876)
Plasmid#114078PurposeCAG promoter expression plasmid for human codon optimized AsCas12a-VPR(1.1)DepositorInserthuman codon optimized DNase-inactive (D908A) enAsCas12a fused to VPR activation domain
TagsSV40 NLSExpressionMammalianAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCJ202
Plasmid#162675PurposepET-21b(+) based plasmid for expression of PETase from Ideonella sakaiensis 201-F6 (Genbank GAP38373.1), codon optimized for expression in E. coli K12, with C-terminal His tag, incorporating W159C and S238C mutations.DepositorInsertPETase from Ideonella sakaiensis 201-F6 (Genbank GAP38373.1)
TagsHisExpressionBacterialMutationW159C, S238C; codon optimized for expression in E…PromoterT7/lacAvailable SinceFeb. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
CA-RIT-NFAT1 (PGK-Puro)
Plasmid#63214PurposeConstitutively active NFAT1, mutated to interfere selectively with the NFAT:AP-1 interactio. Contains Puromycin selection markerDepositorInsertCA-RIT-NFAT1 (Nfatc2 Mouse)
UseRetroviralTagsHAExpressionMammalianMutationAmino acids 1-3 removed; CA: PASSGSSASF mutated t…Available SinceJuly 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T2-Ste7-EE
Plasmid#52681Purposeexpression of constitutively active Ste7 kinase in bacteriaDepositorInsertSte7 (STE7 Budding Yeast)
TagsGST and MycExpressionBacterialMutationS359E/T363E constitutively activePromotertacAvailable SinceApril 30, 2014AvailabilityAcademic Institutions and Nonprofits only -
pTF-ACE2s
Plasmid#162786PurposeThe extracellular domain of Angiotensin converting enzyme 2 (ACE2) expressionDepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
Tags10xHis, FLAG, and hTPA leaderExpressionMammalianPromoterCHO EEF1A1 (Translation Elongation Factor 1 Alpha…Available SinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hMbCas12a-NLS(nucleoplasmin)-3xHA (AAS2134)
Plasmid#114090PurposeCAG promoter expression plasmid for human codon optimized MbCas12a nuclease with C-terminal NLS and HA tagDepositorInserthuman codon optimized MbCas12a
TagsNLS(nucleoplasmin) and 3xHAExpressionMammalianAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCJ199
Plasmid#162672PurposepET-21b(+) based plasmid for expression of the putative MHET hydrolase from Comamonas thiooxydans (Genbank WP_080747404.1) with C-terminal His tag, codon optimized for expression in E. coli K12.DepositorInsertPutative MHET hydrolase from Comamonas thiooxydans (Genbank WP_080747404.1) with signal peptide
TagsHisExpressionBacterialMutationcodon optimized for expression in E. coli K12PromoterT7/lacAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-20a-3p
Plasmid#103341PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-20a-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-20a-3p target (MIR20A Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCJ197
Plasmid#162670PurposepET-21b(+) based plasmid for expression of MHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1), codon optimized for expression in E. coli K12, with C-terminal His tag, incorporating S131G mutation.DepositorInsertMHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1
TagsHisExpressionBacterialMutationS131G; codon optimized for expression in E. coli …PromoterT7/lacAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
NET23 pEGFP-N2 (1174)
Plasmid#62037Purposemammalian expression of nuclear envelope transmembrane proteinDepositorAvailable SinceAug. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCJ203
Plasmid#162678PurposepET-21b(+) based plasmid for expression of the putative MHET hydrolase from Comomonas thiooxydans (Genbank WP_080747404.1) with deletion of the predicted signal peptide (Phe2:Ala75)DepositorInsertPutative MHETase from Comomonas thiooxydans (Genbank WP_080747404.1) without 75 residue signal peptide
TagsHisExpressionBacterialMutationdeltaF2-A75; codon optimized for expression in E.…PromoterT7/lacAvailable SinceFeb. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCJ205
Plasmid#162676PurposepET-21b(+) based plasmid for expression of MHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1), codon optimized for expression in E. coli K12, with C-terminal His tag, incorporating C224A anDepositorInsertMHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1)
TagsHisExpressionBacterialMutationC224A, C529A; codon optimized for expression in E…PromoterT7/lacAvailable SinceFeb. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCJ198
Plasmid#162671PurposepET-21b(+) based plasmid for expression of MHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1), codon optimized for expression in E. coli K12, with C-terminal His tag, incorporating F495I mutation.DepositorInsertMHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1)
TagsHisExpressionBacterialMutationF495I; codon optimized for expression in E. coli …PromoterT7/lacAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only