We narrowed to 4,446 results for: GCA
-
Plasmid#224569PurposeUbiquitous expression plasmid, CAG promoter (CMV immediate early enhancer and chicken beta actin promoter), three unique Pax7 gRNAs with ribozyme self-cleavage sites, and membrane RFP reporter.DepositorInsertmRFP1
UseCRISPRTagsMembrane localization signalMutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MCS-shCHD5 #2
Plasmid#68877PurposeCHD5 shRNA expressed from Adeno-associated viral (AAV) vectorDepositorInsertCHD5
UseAAV and RNAiExpressionMammalianPromoterH1Available SinceSept. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-MAVS-ts1
Plasmid#174274PurposeMAVS knockdownDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPBC-LG3-tdT
Plasmid#62810PurposepPBC-LG3-tdT expresses PiggyBac inverted terminal repeat-flanked Lck-GCaMP3 and tdTomato under the control of the CAG promoter.DepositorInsertITR-CAG-Lck-GCaMP3-IRES-tdTomato-ITR
ExpressionBacterial and MammalianPromoterCAGAvailable SinceMay 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgGrin2a
Plasmid#124850PurposeMutagenesis of Grin2aDepositorInsertGrin2a (Grin2a Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
shRNA_circHUWE1_2
Plasmid#215235PurposeSupression of shcircHUWE1(19,20)_2 expressionDepositorInsertcircHUWE1 shRNA 2 (HUWE1 Human)
UseLentiviralAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSIL-eGFP-shACTN4
Plasmid#52679PurposeshRNA against α-actinin-4 with eGFP transfection markerDepositorAvailable SinceJune 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
PKN3 gRNA (BRDN0001487150)
Plasmid#77950Purpose3rd generation lentiviral gRNA plasmid targeting human PKN3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pT7-gfap-sgRNA
Plasmid#65566Purposein vitro trancription of sgRNA targeting the zebrafish gfap locusDepositorAvailable SinceJune 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Hygro-sgSIK3
Plasmid#138699PurposeExpresses a human SIK3-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgSHOC2-1
Plasmid#86128PurposeLentiviral vector expressing Cas9 and an sgRNA targeting SHOC2DepositorAvailable SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
shYES1 # 1
Plasmid#42546DepositorAvailable SinceFeb. 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
pRSET a sfMatryoshCaMP6s-T78H
Plasmid#100021PurposeBacterial expression of fluorescent reporter for calcium signaling, based off of GCaMP6s. Contains a stable reference LSSmOrange nested within the reporting superfolder cpGFP-T78HDepositorInsertsfMatryoshCaMP6s
Tags6x HIS tag and Xpress_EK tagExpressionBacterialMutationcpEGFP replaced with superfolder cpGFP and T78H m…PromoterT7Available SinceOct. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
ROCK1 gRNA (BRDN0001147709)
Plasmid#77593Purpose3rd generation lentiviral gRNA plasmid targeting human ROCK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSMP-Ehmt1_1
Plasmid#36335DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pGL-p21UTRm1
Plasmid#20878DepositorInsertp21 3'UTR site 1 mutation (Cdkn1a Mouse)
UseLuciferaseExpressionMammalianMutationPredicted miRNA binding site 1 (Position ~420) GC…Available SinceAug. 5, 2009AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-SIK3
Plasmid#138697PurposeExpresses a human SIK3-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
bu6-sgCebpa_v2-mU6-sgCebpb_v2-hU6-sgCebpd_v2
Plasmid#177258PurposeExpresses Cebpa_v2 (bU6), Cebpb_v2 (mU6), Cebpd_v2 (hU6) gRNAs and Cre-recombinaseDepositorInsertsgCebpa_v2/sgCebpb_v2/sgCebpd_v2
UseLentiviralPromoterbU6/mU6/hU6Available SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSC4
Plasmid#91182PurposeT-DNA vector for targeted deletion of 58kb region in Medicago truncatula (tRNA array of 6 gRNAs under the control of CmYLCV promoter)DepositorInsertgRNAs targeting 58kb region in medicago truncatula
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only