We narrowed to 7,853 results for: 11
-
Plasmid#65661PurposeFLAG-HA expression vector with RBPMS carrying mutation F27A and encoding silent mutation to render resistant to siRNA R2 (Farazi et al. 2014)DepositorInsertRBPMS (RBPMS Human)
TagsFLAG HAExpressionMammalianMutationchanged phenylalanine 27 to alanine (KDR backgrou…PromoterCMV, 2x TetAvailable SinceJune 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
UASp-Fz4
Plasmid#52400PurposeOver-expression of Drosophila Frizzled 4DepositorAvailable SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
tdEos-Supervillin-45
Plasmid#57671PurposeLocalization: Membrane/Actin, Excitation: 505 / 569, Emission: 516 / 581DepositorInsertSupervillin
TagstdEosExpressionMammalianPromoterCMVAvailable SinceJan. 16, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
p416GAL1-Skn7t-L-IFP-F[1] (Yeast)
Plasmid#52896PurposeSkn7t replaces the zipper and is fused to the IFP-F[1] through the linker (GGGGS) X 2. Plasmid confers ampicillin resistance to DH5α.DepositorInsertSkn7t-L-IFP-F[1]
TagsL-IFP-F[1]ExpressionYeastPromoterGAL1Available SinceJune 12, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-HA-shift-IRES-GFP(KaganE21)
Plasmid#52004PurposeExpresses the human MAVS CDS containing an N-terminal HA tag and a frameshift mutation inserting TA at bp number 254 of the MAVS CDS . And a GFP markerDepositorInsertMAVS-Shift
UseRetroviralTagsHAExpressionMammalianMutationA 2 nucleotide insertion was introduced between t…Available SinceApril 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
MR015-PKP2 Right TALEN_NN
Plasmid#49452PurposeRight TALEN for PKP2 with NNDepositorInsertTALEN
UseTALENExpressionMammalianAvailable SinceJan. 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
MR015-PKP2 Right TALEN_NK
Plasmid#49480PurposeRight TALEN for PKP2 with NKDepositorInsertTALEN
UseTALENExpressionMammalianAvailable SinceDec. 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
MR015-PKP2 Left TALEN_NK
Plasmid#49479PurposeLeft TALEN for PKP2 with NKDepositorInsertTALEN
UseTALENExpressionMammalianAvailable SinceDec. 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
MR015-PRKAG2 Right TALEN
Plasmid#49454PurposeRight TALEN for PRKAG2DepositorInsertTALEN
UseTALENExpressionMammalianAvailable SinceDec. 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
MR015-PRKAG2 Left TALEN
Plasmid#49453PurposeLeft TALEN for PRKAG2DepositorInsertTALEN
UseTALENExpressionMammalianAvailable SinceDec. 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
-
-
-
-
pSpCas9(BB)-2A-Puro (PX459) V2.0
Plasmid#62988PurposeCas9 from S. pyogenes with 2A-Puro, and cloning backbone for sgRNA (V2.0)DepositorInserthSpCas9-2A-Puro V2.0
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterCbhAvailable SinceMarch 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_cAMPFIRE-M
Plasmid#182280PurposeMammalian expression of the cAMP sensor cAMPFIRE-M under a CMV promotor.DepositorInsertcAMPFIRE-M (cAMP sensor)
ExpressionMammalianAvailable SinceMarch 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pB-mTSPAN4-GFP
Plasmid#210329PurposeOverexpression of mTSPAN4DepositorAvailable SinceFeb. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMIY-mETV3
Plasmid#34578DepositorAvailable SinceDec. 16, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.3/V5-DEST-GFP
Plasmid#40125DepositorInsertGFP
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceJuly 16, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1363 LV EF1a-CD19 IRES-EGFP
Plasmid#201919Purpose2nd generation lentiviral transfer plasmid for engineering cells to express human CD19DepositorAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
DT0
Plasmid#80418PurposeExpresses 0 CUG repeats in the context of human DMPK genomic segment containing exons 11-15 with repeats inserted at site in exon 15 that contains the repeatsDepositorInserthuman DMPK exons 11-15 with 0 CTG repeats (DMPK Human)
ExpressionMammalianAvailable SinceSept. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
DT480
Plasmid#80413PurposeExpresses 480 interrupted CUG repeats in the context of human DMPK genomic segment containing exons 11-15 with repeats inserted at site in exon 15 that contains the repeatsDepositorInserthuman DMPK exons 11-15 with 480 interrupted CTG repeats (DMPK Human)
ExpressionMammalianAvailable SinceSept. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
DT240
Plasmid#80414PurposeExpresses 240 interrupted CUG repeats in the context of human DMPK genomic segment containing exons 11-15 with repeats inserted at site in exon 15 that contains the repeatsDepositorInserthuman DMPK exons 11-15 with 240 interrupted CTG repeats (DMPK Human)
ExpressionMammalianAvailable SinceSept. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
DT40
Plasmid#80415PurposeExpresses 40 interrupted CUG repeats in the context of human DMPK genomic segment containing exons 11-15 with repeats inserted at site in exon 15 that contains the repeatsDepositorInserthuman DMPK exons 11-15 with 40 interrupted CTG repeats (DMPK Human)
ExpressionMammalianAvailable SinceSept. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
hSTARR-seq_SCP1 vector_blocking 4
Plasmid#99319PurposeVector to measure enhancer activity of candidates from a DNA library by STARR-seq.DepositorTypeEmpty backboneUseHstarr-seq screening vectorExpressionMammalianAvailable SinceSept. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
hSTARR-seq_SCP1 vector_blocking 3
Plasmid#99318PurposeVector to measure enhancer activity of candidates from a DNA library by STARR-seq.DepositorTypeEmpty backboneUseHstarr-seq screening vectorExpressionMammalianAvailable SinceSept. 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
mCherry-cGAS-HA
Plasmid#231895PurposeExpression of cyclic GMP/AMP synthase (cGAS), as a nuclear rupture markerDepositorAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
DT960
Plasmid#80412PurposeExpresses 960 interrupted CUG repeats in the context of human DMPK genomic segment containing exons 11-15 with repeats inserted at site in exon 15 that contains the repeatsDepositorInserthuman DMPK exons 11-15 with 960 interrupted CTG repeats (DMPK Human)
ExpressionMammalianAvailable SinceSept. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-D50 lamin A
Plasmid#17653DepositorInsertD50 lamin A (LMNA Human)
TagsEGFPExpressionMammalianMutationDelta 50 (50 aa internal deletion in globular tai…PromoterCMVAvailable SinceMarch 27, 2008AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-Puro (PX462) V2.0
Plasmid#62987PurposeCas9n (D10A nickase mutant) from S. pyogenes with 2A-Puro, and cloning backbone for sgRNA (V2.0)DepositorInserthSpCas9n-2A-Puro
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianMutationCas9 D10A nickase mutantAvailable SinceMarch 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Puro CAG FUCCI
Plasmid#136934Purposedonor plasmid for constitutive FUCCI expression in human cellsDepositorInsertClover-Geminin(1-110)-IRES-mKO2-Cdt(30-120)
UseSynthetic BiologyTagsClover and mKO2ExpressionMammalianPromoterCAGAvailable SinceApril 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
TurboID-CRaf
Plasmid#226168PurposeLentiviral plasmid used to express a TurboID fusion of the protein kinase CRaf.DepositorInsertMyc-TurboID-CRaf (RAF1 Human)
UseLentiviralTagsEGFP-IRES-BlastR and Myc-TurboIDExpressionMammalianAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Cyto-ExRai-CKAR2
Plasmid#236097PurposeCytosol-targeted enhanced excitation-ratiometric biosensor for monitoring Protein Kinase C activity in living cells.DepositorInsertExRai-CKAR2-NES
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianPromoterCMVAvailable SinceMay 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
DT12A
Plasmid#80416PurposeExpresses 12 CUG repeats in the context of human DMPK genomic segment containing exons 11-15 with repeats inserted at site in exon 15 that contains the repeatsDepositorInserthuman DMPK exons 11-15 with 12 CTG repeats (DMPK Human)
ExpressionMammalianAvailable SinceSept. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-HA-JMJD3
Plasmid#24167PurposeMammalian expression of human JMJD3 with HA tagDepositorAvailable SinceJan. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
hSTARR-seq_ORI vector
Plasmid#99296PurposeVector to measure enhancer activity of candidates from a DNA library by STARR-seq.DepositorTypeEmpty backboneUseHstarr-seq screening vectorExpressionMammalianAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pOP823
Plasmid#235718PurposeProtein expression of His6-SUMO-HsRAB5A (Q79L C19S,C63S) 1-212 in bacteria for maleimide conjugationDepositorAvailable SinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-TORCAR
Plasmid#64927PurposeFRET-based biosensor for monitoring mTORC1 kinase activity.DepositorAvailable SinceJuly 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGGAselect
Plasmid#195714PurposepGGAselect is a cloning vector for Golden Gate Assembly using BsaI, BsmBI, and BbsI Type IIS restriction enzymes.DepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceFeb. 24, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pADH100Cau
Plasmid#244817PurposeModified plasmid from pADH100 to perform HIS-FLP CRISPR in Candidozyma aurisDepositorInsertSNR52p from C. auris
UseCRISPRTagsHIS1 terminator from C. auris and NAT resistance …ExpressionYeastPromoterSNR52pAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_EF1a_DIO_HA/FLAG_muMASS_LF
Plasmid#213394PurposeLoss of function variant of uMASS_1 opioid sensor. AAV virus production for Cre dependent expression.DepositorInsertuMASS_LF
UseAAV and Cre/LoxExpressionMammalianAvailable SinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-HA-UTX
Plasmid#24168PurposeMammalian expression of human UTX with HA tagDepositorAvailable SinceJan. 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
pTW072M
Plasmid#115960PurposeDestination VectorDepositorInsertLvl2 (nsP2 Q739L)
UseSynthetic BiologyMutationnsP2 Q739LAvailable SinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pChREBP
Plasmid#39235DepositorAvailable SinceNov. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1365 LV EF1a-CD28 IRES-EGFP
Plasmid#201921Purpose2nd generation lentiviral transfer plasmid for engineering cells to express human CD28DepositorAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only