We narrowed to 5,265 results for: crispr cas9 expression plasmids
-
Plasmid#192126PurposeExpresses Hsp2Cas9DepositorInsertHsp2Cas9
UseAAVExpressionMammalianAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-Hsp1Cas9
Plasmid#192125PurposeExpresses Hsp1Cas9DepositorInsertHsp1Cas9
UseAAVExpressionMammalianAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-H2BC11_sgRNA
Plasmid#183883PurposepX459V2.0-HypaCas9 plasmid with H2BC11 sgRNA for C-terminal tagging of H2B histones in human cells.DepositorAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-MYH10_sgRNA
Plasmid#183887PurposepX459V2.0-HypaCas9 plasmid with MYH10 sgRNA for N-terminal tagging of myosin heavy chain 10 in human cells.DepositorAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-CfANLN_sgRNA
Plasmid#183880PurposepX459V2.0-HypaCas9 plasmid with cfANLN sgRNA for N-terminal tagging of anillin in canine (Canis familiaris) cells.DepositorInsertCanis familiaris ANLN sgRNA spacer
UseCRISPRExpressionMammalianPromoterU6Available SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJUMP29[dCas9]-1A(lacZ)
Plasmid#126979PurposeLevel 1 vector. With lacZ as alternative cloning reporter.OriV 9 (pBBR322/ROP; medium copy number). Constitutive dCas9 in downstream secondary site.DepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialMutationCas9 catalytically deadAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
Native promoter dCas9
Plasmid#113656PurposedCas9 expression unit plasmid. The dCas9 expression unit plasmids contain connector ConL1, ConRE, and one dCas9 transcriptional unit.DepositorInsertNative promoter and dCas9
UseCRISPRExpressionBacterialPromoterS. pyogenes Cas9 native promoterAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-SYN-NLS-SaCas9-NLS-3xHA-bGHpA-U6-BsaI-sgRNA
Plasmid#218710PurposeAAV vector plasmid expressing Cas9 from Staphylococcus aureus (SaCas9) under the human synapsin (SYN) promoter and its sgRNA under the U6 promoterDepositorInsertshSaCas9
Chimeric guide for SaCas9
UseAAV and CRISPRTags3xHA and NLSExpressionMammalianAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-TadCBEd-SpCas9(LWKYQS)-P2A-EGFP (BKS1014)
Plasmid#223127PurposepCMV and pT7 Human expression plasmid for TadCBEd using SpCas9 CBE enzyme with LWKYQS amino acids at positions 1135,1136,1218,1219,1335,T1337 with C-term BPNLS-P2A-EGFPDepositorInserthuman codon optimized TadA-CDd-SpCas9(LWKYQS)-2xUGI-P2A-EGFP
UseCRISPRTags2xUGI-BPNLS-P2A-EGFP and BPNLS-TadA-CDdExpressionMammalianMutationTadA-CDd mutations; nSpCas9(D10A/LWKYQS)=D1135L, …PromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8e-SpCas9(LWRYEK)-P2A-EGFP (BKS1028)
Plasmid#223114PurposepCMV and pT7 Human expression plasmid for ABE8e using SpCas9 enzyme with LWRYEK amino acids at positions 1135,1136,1218,1219,1335,T1337 with C-term BPNLS-P2A-EGFPDepositorInserthuman codon optimized TadA8e-SpCas9(LWRYEK)-P2A-EGFP
UseCRISPRTagsBPNLS-P2A-EGFP and BPNLS-TadA8eExpressionMammalianMutationTadA8e mutations; nSpCas9(D10A/LWRYEK)=D1135L, S1…PromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eCas9-T2A-EGFP-U6-gRNA-no ITR and f1 ori
Plasmid#234724PurposeAll-in-one CRISPR/Cas9 vector with high-fidelity eSpCas9 expression in neurons. The plasmid lacks AAV2 ITR and f1 ori elements, enabling more efficient transfection and expression.DepositorTypeEmpty backboneUseCRISPRTagsT2A-GFPExpressionMammalianPromoterCAG promoterAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EF1alpha-dCas9-VP64-MS2-VP64-Blast
Plasmid#192666Purpose3rd generation lenti vector encoding dCas9-VP64 with P2A MS2-VP64 and T2A Blast resistance markerDepositorInsertdCas9-VP64, MS2-VP64
UseCRISPR and LentiviralExpressionMammalianMutationD10A and N863A in Cas9PromoterEF1aAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EF1alpha-dCas9-VP64-MS2-VP64-ZsG
Plasmid#192665Purpose3rd generation lenti vector encoding dCas9-VP64 with P2A MS2-VP64 and T2A ZsGreen1DepositorInsertdCas9-VP64, MS2-VP64, ZsGreen1
UseCRISPR and LentiviralExpressionMammalianMutationD10A and N863A in Cas9PromoterEF1aAvailable SinceDec. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
KN801: pMAGIC (R4-R3) NLS-x dCas9(3.7)-NLS-VPR
Plasmid#121829PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS x-dCas9(3.7) fused to the VPR transcriptional activator for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertx-dCas9(3.7)/VPR (open)
UseGateway Cloning and Synthetic BiologyTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KN901: pMAGIC (R4-R3) NLS-x dCas9(3.7)-NLS-KRAB
Plasmid#121830PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS x-dCas9(3.7) fused to the KRAB transcriptional repressor for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertx-dCas9(3.7)/KRAB (open)
UseGateway Cloning and Synthetic BiologyTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KO001: pMAGIC (R4-R3) NLS-x dCas9(3.7)-NLS-p300core
Plasmid#121832PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS x-dCas9(3.7) fused to the p300 catalytic core for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertx-dCas9(3.7)/p300core (open)
UseGateway Cloning and Synthetic BiologyTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
LG002: pMAGIC (L1-R5) mU6::xCas9(3.7) gRNA scaffold
Plasmid#121816PurposepMAGIC L1-R5 entry plasmid, contains empty mouse U6-driven xCas9(3.7) (i.e. SpCas9) gRNA scaffold for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestionDepositorTypeEmpty backboneUseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-RSV-GFP-U6-EMX1 gRNA (SpyCas9 scaffold)
Plasmid#113040PurposeAAV vector; encodes GFP as well as a U6-driven EMX1-targeting gRNA (SpyCas9 scaffold)DepositorInsertgRNA EMX1 (SpCas9 scaffold), co-expressed GFP (transfection marker)
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJAT11
Plasmid#204290PurposeFor inserting a phiC31 attP site. HDR integrant is marked with removable ie1-DsRed cassette, which is expressed in abdomen and mouthparts.DepositorInsertie1-DsRed
UseCRISPRPromoterie1Available SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only