We narrowed to 299 results for: IPTG
-
Plasmid#106902PurposepQE30del is conditionally replicating empty vector. Replication of the plasmid is inhibited in presense of IPTG or lactose. pQE30del can be used for construction of any E. coli helper plasmids.DepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterAvailable sinceJune 15, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pKB083
Plasmid#181952PurposeIPTG-inducible expression of PhoQDepositorInsertPhoQ; lacI (lacI PhoQ - Salmonella enterica subsp. enterica serovar Typhimurium; lacI - E. coli)
UseTagsExpressionBacterialMutationPromoterPhoQ-Ptac; lacI-PlacIqAvailable sinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHnCBS1D
Plasmid#52065Purposeexpresses nine genes from the H. neapolitanus carboxysome operon and CSOS1D; IPTG-inducibleDepositorInsertCbbL, CbbS, CSOS2, CSOS3, CSOS4A, CSOS4B, CSOS1C, CSOS1A, CSOS1B, CSOS1D
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pNVLTv2-pvdIJD-Ptrc-base
Plasmid#169243PurposeSuicide vector for integrating expression cassette in P. putida (IPTG induction)DepositorInsertlacI
UseTagsExpressionBacterialMutationPromoterlacIqAvailable sinceJune 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTDpelB-CTwinStrep
Plasmid#45941Purposeuse to create N-terminal PelB and C-terminal Twin-Strep-tagged fusion proteins for periplasmic translocation via PelB signal sequenceDepositorTypeEmpty backboneUseTagsPelB and Twin-StrepExpressionBacterialMutationPromoterTrc (lactose/IPTG inducible)Available sinceSept. 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pKD317.8
Plasmid#181951PurposeIPTG-inducible expression of NarXDepositorUseTagsExpressionBacterialMutationPromoterNarX-Ptac; lacI-PlacIqAvailable sinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOPO635
Plasmid#195297PurposepACYC-plac-MycaTnsABC, lac promoter expressing transposase genes TnsABC of McCAST (Tn7575).DepositorInsertTnsABC operon of McCAST (Tn7575)
UseTagsExpressionBacterialMutationPromoterIPTG inducible lac promoterAvailable sinceMay 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHnCB
Plasmid#52064Purposeexpresses nine genes from the H. neapolitanus carboxysome operon; IPTG-inducibleDepositorInsertCbbL, CbbS, CSOS2, CSOS3, CSOS4A, CSOS4B, CSOS1C, CSOS1A, CSOS1B
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pOPO636
Plasmid#195299PurposepACYC-plac-MycaTnsABCQ, lac promoter expressing transposase genes TnsABCQ of McCAST (Tn7575).DepositorInsertTnsABCQ operon of McCAST (Tn7575)
UseTagsExpressionBacterialMutationPromoterIPTG inducible lac promoterAvailable sinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCas61
Plasmid#82397PurposeIPTG inducible, cLac143 (Markley 2015), LDH V39R with Gmr in glpKDepositorInsertLDH
UseTagsExpressionMutationV39RPromotercLac143Available sinceOct. 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pETM11-6xHis-TEV-hORF1p_R261A
Plasmid#202586PurposeAllows for IPTG-inducible expression of the human L1RP ORF1 protein with the R261A mutations in bacteria with an N-terminal 6xHis tag and TEV cleavage site for purification with a minimal scarDepositorInsertORF1p
UseTags6x His and TEV protease cleavage siteExpressionBacterialMutationChanged ORF1p Arginine 261 to AlaninePromoterAvailable sinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pO5
Plasmid#193749PurposeExpresses tdTomato under the control of PIAH synthetic promoter regulated by AHL and IPTG, p15A origin of replication, Chloramphenicol selectionDepositorInserttdTomato
UseTagsExpressionBacterialMutationPromoterPIAHAvailable sinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pO6
Plasmid#193747PurposeExpresses E2-Crimson under the control of PIAH synthetic promoter regulated by AHL and IPTG, p15A origin of replication, Chloramphenicol selection,DepositorInsertE2-Crimson
UseTagsExpressionBacterialMutationPromoterPIAHAvailable sinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
Sender_plasmid2
Plasmid#140693PurposeEncodes inducible expression of RhlI (C4-HSL quorum sensing synthase)DepositorInsertRhlI (rhlI )
UseTagsssrA degradation tag (ASV)ExpressionBacterialMutationPromoterengineered lac promoter (IPTG inducible)Available sinceMay 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET-28a(+)::NL
Plasmid#141289PurposeNLUC in pET-28 a (+) backbone for bacterial IPTG inducible expression (KmR)DepositorInsertNLUC
UseLuciferaseTagsExpressionBacterialMutationEngineered for high stability (t1/2 = 11.5 days a…Promoterpromoter for bacteriophage T7 RNA polymeraseAvailable sinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTD-NTwinStrep_Sm
Plasmid#45937Purposeuse to create N-terminal Twin-Strep-tag fusion proteins or dual tagged fusion with N-terminal Twin-Strep-tag and C-terminal 6x His-tagDepositorTypeEmpty backboneUseTags6xHis and Twin-StrepExpressionBacterialMutationPromoterTrc (lactose/IPTG inducible)Available sinceSept. 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pTD-NTwinStrep_Km
Plasmid#45938Purposeuse to create N-terminal Twin-Strep-tag fusion proteins or dual tagged fusion with N-terminal Twin-Strep-tag and C-terminal 6x His-tagDepositorTypeEmpty backboneUseTags6xHis and Twin-StrepExpressionBacterialMutationPromoterTrc (lactose/IPTG inducible)Available sinceSept. 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET28a(+)::NL3F10H
Plasmid#141290PurposeNLUC:3xFlag:10xHis in pET-28 a (+) backbone for bacterial IPTG inducible expression (KmR)DepositorInsertNLUC3F10H
UseLuciferaseTagsFlag (x3) and His (x10)ExpressionBacterialMutationEngineered for high stability (t1/2 = 11.5 days a…Promoterpromoter for bacteriophage T7 RNA polymeraseAvailable sinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET21a - NR
Plasmid#89625PurposeExpresses recombinant 6HIS tagged T. cruzi nitrate reductase in E. coli upon IPTG inductionDepositorInsertNitrate reductase
UseTags6HIS and T7 tag (gene 10 leader)ExpressionBacterialMutationPromoterAvailable sinceMay 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMGA-ptac-sfGFP
Plasmid#139934PurposeIPTG-inducible sfGFP expression on M. magneticum/E. coli shuttle vectorDepositorInsertLacI-Ptac-sfGFP
UseTagsExpressionBacterialMutationPromoterAvailable sinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFW2100
Plasmid#224212PurposeBacteroides genomic editing tool; IPTG inducible-Fncpf1DepositorInsertFncpf1
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET11a-Z-NGFP
Plasmid#52734PurposeIPTG-inducible expression of Z-NGFP positive control for in vivo split GFP assembly assayDepositorInsertNGFP+Z-fusion
UseTagsHis tagExpressionBacterialMutationPromoterT7Available sinceJune 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pYC01
Plasmid#224586PurposeIPTG-inducible phage φX174 lysis gene EDepositorInsertphage φX174 lysis gene E (phiX174p08 )
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPA1lacO-1Available sinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pETM11-6xHis-TEV-hORF1p_K3AK4A
Plasmid#202585PurposeAllows for IPTG-inducible expression of the human L1RP ORF1 protein with the K3A and K4A mutations in bacteria with an N-terminal 6xHis tag and TEV cleavage site for purification with a minimal scarDepositorInsertORF1p
UseTags6x His and TEV protease cleavage siteExpressionBacterialMutationChanged ORF1p Lysine 3 to Alanine, changed ORF1p …PromoterAvailable sinceNov. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
DT044A
Plasmid#159405PurposeInducible Perfringolysin O (PFO) expression and purification, controlled under hybrid IPTG-regulated T7/LacO promoter (pRT30)DepositorInsertpr.T7-LacO-6xHis-PFO (Pfo, Clostridium perfringens)
UseSynthetic BiologyTags6xHisExpressionBacterialMutationPromoterT7/LacO promoterAvailable sinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKPY514
Plasmid#62598PurposeEncodes Thr251Gly-EcPheRS Under IPTG-Inducible (PT5) ControlDepositorInsertThr251Gly-EcPheRS
UseTags6xHisExpressionBacterialMutationThr251GlyPromoterT5Available sinceMarch 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET21a - GR
Plasmid#89614PurposeExpresses recombinant 6HIS tagged T. cruzi Glutathione reductase protein in E. coli upon IPTG inductionDepositorInsertGlutaredoxin
UseTags6HISExpressionBacterialMutationPromoterAvailable sinceMay 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pETM11-6xHis-TEV-hORF1p_StammerAAA
Plasmid#202587PurposeAllows for IPTG-inducible expression of the human L1RP ORF1 protein with the M91A, E92A, and L93A mutations in bacteria with an N-terminal 6xHis tag and TEV cleavage site for purificationDepositorInsertORF1p
UseTags6x His and TEV protease cleavage siteExpressionBacterialMutationChanged ORF1p Methionine 91 to Alanine, ORF1p Glu…PromoterAvailable sinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pETM11-6xHis-TEV-hORF1p_StammerAEA
Plasmid#202588PurposeAllows for IPTG-inducible expression of the human L1RP ORF1 protein with the M91A and L93A mutations in bacteria with an N-terminal 6xHis tag and TEV cleavage site for purificationDepositorInsertORF1p
UseTags6x His and TEV protease cleavage siteExpressionBacterialMutationChanged ORF1p Methionine 91 to Alanine, changed O…PromoterAvailable sinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG1
Plasmid#188967PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtggaaaacaatgcgaccgactagt
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPtrcAvailable sinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only