-
Plasmid#170118PurposeAAV vector carrying a guide RNA targeting the human RAB7A mRNADepositorInsertCircular 200,100 guide RNA (RAB7A Human)
UseAAVTagsExpressionMammalianMutationPromoterHuman U6Available sinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_3
Plasmid#155061PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and two intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and two intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV CAG Barcode2
Plasmid#229063PurposeExpression mappingDepositorInsertCAG Barcode2
UseAAVTagsExpressionMutationPromoterAvailable sinceDec. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUDP123
Plasmid#107269PurposepUDP123 expressing a polycistronic g-RNA array for Cas9 editing targeting the genes OpADE2 and OpNIAD and Spcas9D147Y P411T in O. parapolymorpha (HH-gRNAOpADE2-HDV-linker-HH-gRNAOpNIAD-HDV)DepositorInsertpolycistronic HH-gRNA-HDV-HH-gRNA-HDV array targetting OpADE2 and NIAD in O. parapolymorpha
UseTagsExpressionYeastMutationPromoterScTDH3Available sinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAM/CBA-eGFP-miRNegativex3-WPRE-bGHpA
Plasmid#194249PurposeExpresses 3 non-targeting miRNAsDepositorInsertmiRNegative
UseAAV and RNAiTagsExpressionMutationPromoterCAGAvailable sinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pWT029c
Plasmid#96858Purposeguanine-agRNA (GFP activation)DepositorInsertguanine-agRNA (GFP activation)
UseTagsExpressionMammalianMutationPromoterAvailable sinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pWT029g
Plasmid#96860Purposeguanine-agRNA (GFP activation, 18 nt blocker with bulges)DepositorInsertguanine-agRNA (GFP activation, 18 nt blocker with bulges)
UseTagsExpressionMammalianMutationPromoterAvailable sinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pWT049d
Plasmid#96862Purposeguanine-agRNA (19 nt blocker with bulges, RFP activation)DepositorInsertguanine-agRNA (19 nt blocker with bulges, RFP activation)
UseTagsExpressionMammalianMutationPromoterAvailable sinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAW218
Plasmid#113240PurposeE. coli expression vector for untagged E. coli Cas1 + Cas2 with CRISPR array, leader IHF binding site flipDepositorInsertsCas1
Cas2
Leader-repeat
UseTagsExpressionBacterialMutationAAAAAATCATTAATTAATAATAGGTTATG->CATAACCTATTATTA…PromoterAvailable sinceAug. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
L4440_BioBrick-hif-1-sgRNA-B
Plasmid#177785PurposeOverexpression of sgRNAs in E. coli HT115 (targeting C. elegans hif-1 promoter)DepositorInserthif-1 (hif-1 Nematode)
UseTagsExpressionBacterialMutationPromoterAvailable sinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 with interspersed loops (SMAD4)
Plasmid#180191PurposeAAV vector carrying a guide RNA targeting the human SMAD4 mRNADepositorInsertCircular 200,100 guide RNA with interspersed loops
UseAAVTagsExpressionMammalianMutationPromoterHuman U6Available sinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSC2
Plasmid#91180PurposeT-DNA vector for combinatorial deletion of NCR genes in medicago truncatula (Csy4 array of 6 gRNAs under the control of CmYLCV promoter)DepositorInsertgRNAs targeting NCR genes
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pATZ-BFP-HA-GFP11
Plasmid#177721PurposeER protein alpha-1-antitrypsin containing E342K mutation (ATZ mutant) fused to blue fluorescence protein (BFP) tag protein, an HA tag and the eleventh β-strand of GFPDepositorInsertalpha-1-antitrypsin (SERPINA1 Human)
UseTagsGFP11, HA, and TagBFPExpressionBacterial and MammalianMutationE342K (ATZ mutant)PromoterAvailable sinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
-
pQCXIP-SHMY-A1Pi
Plasmid#182648PurposeMammalian expression vector encoding a protein fusion composed of an N-terminal ER targeting sequence of hemagglutinin (HA), one tyrosine sulfation (TS) motif (Y), myc (M), His6 (H) and A1Pi sequenceDepositorInsertA1Pi (SERPINA1 Human)
UseRetroviralTagsHis6-tag, N-terminal ER targeting sequence of hem…ExpressionMammalianMutationPromoterCMVAvailable sinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
-
pAAV syn Barcode1
Plasmid#229062PurposeExpression mappingDepositorInsertSyn Barcode1
UseAAVTagsExpressionMutationPromoterAvailable sinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only