We narrowed to 1,684 results for: tef
-
Plasmid#131242PurposeMammalian expression of N-terminally Myc-tagged USP7DepositorInsertUbiquitin carboxyl-terminal hydrolase 7 (USP7 Human)
TagsMycExpressionMammalianPromoterCMV enhancer + CMV promoterAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
Human USP7-3X FLAG
Plasmid#225334PurposeLentiviral expression of human USP7 with 3x FLAG tag in mammalian cellsDepositorAvailable SinceSept. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
FRT_htr2c(c)-GFP
Plasmid#79677Purposeserotonin receptor minigene with consensus splice sites that expresses the full length serotonin receptor with a C-terminal EGFPDepositorInsertserotonin receptor 2C (HTR2C Human)
TagsEGFP in FrameExpressionMammalianMutationsplice site of exon Vb in consensusPromoterCMVAvailable SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTXB1-EXO1b D173A
Plasmid#68269PurposeBacterial expression of human EXO1 D173A (catalytically-dead) mutantDepositorInsertEXO1 (EXO1 Human)
TagsMxe intein/chitin binding domainExpressionBacterialMutationcatalytically-dead D173A. Please see depositor co…PromoterT7Available SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCSN067
Plasmid#101748PurposeSingle copy yeast plasmid expressing Cpf1 from Lachnospiraceae bacterium ND2006 (LbCpf1), codon optimized for expression in Saccharomyces cerevisiae.DepositorInsertsCpf1 from Lachnospiraceae bacterium ND2006 (LbCpf1) codon optimized for expression in S. cerevisiae.
KanMX marker expression cassette.
UseCRISPRTagsSV40 NLSExpressionYeastPromoterHeterologous TEF1 promoter from A. gossypii. and …Available SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_Linear Tau 0N4R 3X Flag tag
Plasmid#194171PurposeInsert contains linear tau 0N4R with a 3X Flag tag. Expresses linear protein tau 0N4R with a 3X Flag tag for Immunoprecipitation.DepositorInsertMicrotubule-Associated Protein Tau 0N4R
Tags3X FlagExpressionMammalianAvailable SinceJan. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQFlag-USP7 CS puroR
Plasmid#46752PurposeRetroviral vector that expresses catalytically inactive form of Flag-tagged human USP7DepositorInsertUSP7 (USP7 Human)
UseRetroviralTagsFlagExpressionMammalianMutationC223S--catalytically inactivePromoterCMVAvailable SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMH-SFB-USP7
Plasmid#99393PurposeMammalian expression construct for S protein-Flag-Streptavidin binding peptide (SFB)-tagged USP7DepositorInsertUSP7 (USP7 Human)
TagsSFB (S protein-FLAG-Streptavidin binding peptide)ExpressionMammalianAvailable SinceAug. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV14_NHP2L1(15.5kD)
Plasmid#73065Purposeexpression clone for human NHP2L1 (15.5kD) with C-terminal 3xFLAG-tagDepositorAvailable SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
His-MBP human SPOP (aa 28-337)
Plasmid#52294Purposebacterial expression of human SPOP (aa 28-337) fused to His-MBPDepositorAvailable SinceApril 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
5HT2C-RNA2-Flag
Plasmid#79679Purposeserotonin receptor 2C isoform 2 with C-terminal Flag tag, non-edited isoformDepositorAvailable SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
5HT2C-RNA1-FLAG
Plasmid#79678Purposeserotonin receptor 2C RNA isoform 1 with C-terminal flag tagDepositorAvailable SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
Human USP7_H456A-3X FLAG
Plasmid#225335PurposeLentiviral expression of human mutant USP7 with 3x FLAG tag in mammalian cellsDepositorInsertUSP7 (USP7 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationH456APromoterEF1aAvailable SinceSept. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOGS539_GLuc-ns
Plasmid#226719PurposePlasmid enabling yeast-mediated expression of Gaussia luciferase (GLuc)DepositorInsertGaussia Luciferase
TagsHA tagExpressionYeastPromoterpTEF1Available SinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET26b(+)-ATI_QconCAT_1
Plasmid#163957PurposeExression of ATI QconCAT protein in E. coli expression strains (BL21). Encodes a concatemer of tryptic peptides from wheat amylase/trypsin inhibitors. Used as standard for LC-MS-based quantification.DepositorInsertATI QconCAT
Tagspolyhistidine tagExpressionBacterialPromoterT7 promoterAvailable SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_ZKSCAN1_Tau10-12WT
Plasmid#194163PurposeInsert contains intronic ZKSCAN1 Alu repeat elements flanked by the wild-type tau cDNA exons 10-12. Expresses the tau circRNA 12-->10 WT with 3X flag tag in exon 10.DepositorInsertMicrotubule-associated protein tau 10-12 WT ZKSCAN1 intronic alu elements
Tags3X flag tagExpressionMammalianAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCSP1-mp53AS-6xMUT
Plasmid#20904DepositorInsertp53AS (Trp53 Mouse)
ExpressionMammalianMutationpoint mutation (Ser/Thr-Ala) of the 6 N-terminal …Available SinceApril 22, 2009AvailabilityAcademic Institutions and Nonprofits only -
pYSD726
Plasmid#253049PurposeEncodes OST1 Sig Pep, LC Cutinase-ICCG variant, FLAG-tagged SED1 surface display anchor in a yeast expression vector with pTEF1 promoter, tTDH1 term, LEU2 selectable marker and CEN/ARS originDepositorInsertLeaf compost cutinase
ExpressionYeastMutationY127G, D238C, F243I, S283CAvailable SinceMay 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYSD310
Plasmid#253032PurposeEncodes the MFalpha1 PrePro-app8 signal peptide, Anti-GFP nanobody, HA-tagged 649-stalk yeast surface display anchor protein in a yeast expression vector with pTEF1 promoter, LEU2 selectable markerDepositorInsertAnti-GFP nanobody 649-stalk anchor
ExpressionYeastAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only