We narrowed to 371 results for: abo.3
-
Plasmid#54469PurposeAn amino-terminal YFP fragment was fused to Gbeta-2. When co-expressed with a carboxyl-terminal YFP or CFP fragment fused to a Ggamma subunit, a fluorescent signal is produced.DepositorInsertYFP(1-158)/beta-2 (GNB2 Aequorea victoria, Human)
TagsYFP(1-158) was fused to the amino terminus of Gbe…ExpressionMammalianMutationYFP (1-158) includes a substitution of Met for Gl…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
YFP(1-158)-beta-5 in pcDNAI/Amp
Plasmid#54470PurposeAn amino-terminal YFP fragment was fused to Gbeta-5. When co-expressed with a carboxyl-terminal YFP or CFP fragment fused to a Ggamma subunit, a fluorescent signal is produced.DepositorInsertYFP(1-158)/beta-5 (GNB5 Aequorea victoria, Human)
TagsYFP(1-158) was fused to the amino terminus of Gbe…ExpressionMammalianMutationYFP (1-158) includes a substitution of Met for Gl…Available SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
CFP(159-238)-beta-1 in pcDNAI/Amp
Plasmid#55592PurposeA carboxyl-terminal CFP fragment was fused to Gbeta-1. When co-expressed with an amino-trerminal CFP or YFP fragment fused to a Ggamma subunit, a fluorescent signal is produced.DepositorInsertCFP (159-238)-Beta 1 (GNB1 Aequorea victoria, Human)
TagsCFP(159-238) was fused to the amino terminus of G…ExpressionMammalianMutationCFP(159-238) includes a substitution of His for A…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFB-U6-sgNeuN-gRNA-hSyn-mCherry-WPRE-SV40pA
Plasmid#128346PurposepAAV encoding control gRNA for CRISPR gRNAs listed aboveDepositorAvailable SinceJuly 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCI-MS2V5-PABPC1 M161A/D165K
Plasmid#65809Purposeexpression of PABPC1-MS2 fusion. Mutations abolish binding to eIF4GDepositorInsertPABPC1 (PABPC3 Human)
TagsMS2 stem loops and V5ExpressionMammalianMutationM161A/D165KPromoterCMVAvailable SinceSept. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pXD70DA7-DadR/DadS-Pdadh-DadhABC(A2)
Plasmid#191630PurposeE. coli - Eggerthella lenta shuttle plasmid (KanR), native promoter-dopamine dehydroxylase from dopamine-metabolizing E. lenta A2 strain with transcriptional regulators DadR/DadSDepositorInsertDopamine dehydroxylase
ExpressionBacterialAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXD70Tet(DadHR)-DadR-Pdadh-DadhABC(A2)
Plasmid#191645PurposeE. coli - Eggerthella lenta shuttle plasmid (TetR), native promoter-dopamine dehydroxylase from dopamine-metabolizing E. lenta A2 strain with transcriptional regulator DadRDepositorInsertDopamine dehydroxylase
ExpressionBacterialAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC-hU6-crBACH1-array_EF1a-BFP
Plasmid#224787PurposeBACH1 targeting crRNA array for RfxCas13d expressed from multiple hU6 promoter and reporter BFP protein expressed from EF1a promoterDepositorInsertcrBACH1-1, crBACH1-2, crBACH1-3,
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhU6 and hU6-2xTetOAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUT_mNF-Cas13d-Triplex
Plasmid#227709PurposeLPUtopia matching RMCE donor plasmid with mCherry-P2A-RfxCas13d Negative-Feedback circuit. Include a 3' UTR Triplex motif as a template backbone for MONARCH 2.0 system.DepositorInsertmCherry-P2A-RfxCas13d-Triplex
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterCMV-d2iAvailable SinceNov. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
CMV-10-3xFLAG-LGP2
Plasmid#58681PurposeExpresses 3x Flag-tagged LGP2 in mammalian cellsDepositorInsertlaboratory of genetics and physiology 2 (DHX58 Human)
Tags3x FLAGExpressionMammalianPromoterCMVAvailable SinceJuly 31, 2014AvailabilityAcademic Institutions and Nonprofits only -
inhibin-DsRed
Plasmid#156184PurposeExpression plasmid for production of transgenic rainbow trout strain carrying the DsRed gene under control of the inhibin α promoter.DepositorInsertsrainbow trout inhibin α promoter
rainbow trout β actin 3'UTR
ExpressionBacterialPromoterinhibinAvailable SinceAug. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pXD70DAmt1-DadR/DadS-Pdadh-DadhABC(R506S, A2)
Plasmid#191631PurposeE. coli - Eggerthella lenta shuttle plasmid (KanR), native promoter-dopamine dehydroxylase from dopamine-metabolizing E. lenta A2 strain (R506S mutation) with transcriptional regulators DadR/DadSDepositorInsertDopamine dehydroxylase (R506S mutation, inactive form)
ExpressionBacterialAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-myc-Miro1 E208K/E328K
Plasmid#47894PurposeExpresses myc tagged Miro1 E208K/E328K mutantDepositorInsertMiro1 E208K/E328K (RHOT1 Human)
TagsmycExpressionMammalianMutationE208K/E328K, abolishes calcium bindingPromoterCMVAvailable SinceSept. 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pRK5-myc-Miro2 E208K/E328K
Plasmid#47900PurposeExpresses myc tagged Miro2 V208K/E328K mutantDepositorInsertMiro2 E208K/E328K (RHOT2 Human)
TagsmycExpressionMammalianMutationE208K/E328K, abolishes calcium bindingPromoterCMVAvailable SinceSept. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPRv2-sgPLXNB2
Plasmid#86152PurposeLentivirus carrying Cas9/CRISPR for cut in human PLXNB2 gene exon 3DepositorInsertPlexin-B2 (PLXNB2 Human)
UseCRISPR and LentiviralAvailable SinceJan. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
hSyn-GW-dCas9-SET2-R195G-C201A-IRES2-mCherry
Plasmid#202090PurposeNeuron-specific expression vector of catalytically-dead dCas9-Set2 containing R195G and C201A mutationsDepositorInsertdCas9-Set2(R195G, C201A)
Tags3x FLAG and mCherryExpressionMammalianMutationR195G and C201A abolish catalytic activityPromoterhuman SynapsinAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHW539
Plasmid#198811PurposeDominant negative form of Protein Kinase A (PKA). Lowers PKA activity in targeted neurons.DepositorInsert15xUAS::PKA(DN)-SL2-GFP::let-858 3'UTR
ExpressionWormMutationG310D mutation to abolish the binding of cAMP of …Available SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgPLXNB2
Plasmid#86151PurposeCas9/CRISPR plasmid for cut in human PLXNB2 gene exon 3DepositorInsertPlexin-B2 (PLXNB2 Human)
UseCRISPRAvailable SinceJan. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti.pFOXA2.5'.GFP
Plasmid#59407Purposeexpresses eGFP from an about 1350 bp human FOXA2 promoter to select floor plate and ventral midbrain progenitor cells during developmentDepositorInsertapprox. 1350 bp FOXA2 promoter, eGFP (FOXA2 Human)
UseLentiviralExpressionMammalianPromoterFOXA2Available SinceApril 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
S10A mutant of H3S10ph biosensor
Plasmid#120810PurposeFRET biosensor. Eliminating the H3 Serine 10 phosphorylation site in H3S10ph biosensor to abolish the detection capabilityDepositorInsertMouse histone H3-CFP-FHA2-histone H3 peptide (1-14aa) S10A-YFP
ExpressionMammalianMutationSerine 10 is mutated to Alanine, and Threonine 3,…PromoterCMVAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only