We narrowed to 41,480 results for: kan
-
Plasmid#81204Purposecontains two target sites consisting of PAM-NT1-6bp-gix psuedo site-6bp-NT1-PAM flanking a kan/pA as previously described in the pCALNL-eGFP plasmidDepositorInsertgix-Neo-gix deletion cassette upstream of EGFP
ExpressionMammalianPromoterpCBaAvailable SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pME-APEX2-mCherry
Plasmid#188944PurposeMiddle entry vector for Gateway cloning containing APEX2 tagged to mitochondria and nuclei, and cytoplasmic mCherryDepositorInsertmito-APEX2_p2A_APEX2-H2B_p2A_mCherry
UseMiddle entry vector for gateway (l1-l2)Available SinceOct. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBER
Plasmid#62662PurposeDonor vector for tdTomato knock-in via landing padDepositorInsertstdTomato
hygromycin
UseCre/LoxAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBGX
Plasmid#62666PurposeDonor vector for Dre knock-in via landing padDepositorInsertDre
UseCre/LoxAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBGO
Plasmid#62671PurposeDonor vector for mFTH1 knock-in via landing padDepositorInsertFTH1
UseCre/LoxTagsHAExpressionMammalianAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
p-ArsRBS2-cre[LVA]-loxPP-syfp2
Plasmid#252621PurposeCre-recombinase based arsenite biosensor. ArsR promoter regulates cre expression, which excises two transcriptional terminators leading to cell fluorescence.DepositorInsertParsR-arsR-cre[LVA] + PrpsL-loxP-TT-loxP-syfp2
Tagscre[LVA]ExpressionBacterialPromoterParsRAvailable SinceMarch 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
p-cymR-cre[LVA]-loxPP-eyfp
Plasmid#252620PurposeCumate-inducible Cre recombinase; cumate activates P_cymRC to express cre[LVA], which excises loxP-flanked transcriptional terminators and activates eyfp. Use with Marionette Sensor Collection strainsDepositorInsertcymRAM + PcymRC-cre[LVA] + PW4-loxP-TT-loxP-eyfp
Tagscre[LVA]ExpressionBacterialPromoterPcymRCAvailable SinceMarch 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCHW00015
Plasmid#222446PurposeLevel 0, C terminal tag module (TTCG-GCTT) containig VP64-NLS.DepositorInsertVP64-NLS
UseSynthetic BiologyExpressionPlantMutationnoAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCHW00014
Plasmid#222445PurposeLevel 0, C terminal tag module (TTCG-GCTT) containing VP16-NLS.DepositorInsertVP16-NLS
UseSynthetic BiologyExpressionPlantMutationnoAvailable SinceNov. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCHW110034
Plasmid#222443PurposeLevel 0, N-terminal tag module (CCAT-AATG) containing LoxP-mCherry.DepositorInsertLoxP-mCherry
UseSynthetic BiologyExpressionPlantMutationnoAvailable SinceNov. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC135
Plasmid#202262PurposeLevel 2 for strain-specific barcode DNA tag with bc162 through Tn7 bacterial insertion, Kanamycin selectable marker and tagBFP fluorescent markerDepositorInsertbc162
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC113
Plasmid#202275PurposeLevel 2 for strain-specific barcode DNA tag with bc140 through Tn7 bacterial insertion, Tetracyline selectable marker and far-red-FP fluorescent marker mPlumDepositorInsertbc140
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC115
Plasmid#202277PurposeLevel 2 for strain-specific barcode DNA tag with bc142 through Tn7 bacterial insertion, Tetracyline selectable marker and far-red-FP fluorescent marker mPlumDepositorInsertbc142
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC117
Plasmid#202278PurposeLevel 2 for strain-specific barcode DNA tag with bc144 through Tn7 bacterial insertion, Tetracyline selectable marker and GFP fluorescent markerDepositorInsertbc144
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC118
Plasmid#202279PurposeLevel 2 for strain-specific barcode DNA tag with bc145 through Tn7 bacterial insertion, Tetracyline selectable marker and GFP fluorescent markerDepositorInsertbc145
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC119
Plasmid#202280PurposeLevel 2 for strain-specific barcode DNA tag with bc146 through Tn7 bacterial insertion, Tetracyline selectable marker and GFP fluorescent markerDepositorInsertbc146
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC108
Plasmid#202247PurposeLevel 2 for strain-specific barcode DNA tag with bc135 through Tn7 bacterial insertion, Gentamicin selectable marker and far-red-FP fluorescent marker mPlumDepositorInsertbc135
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only