We narrowed to 4,936 results for: AAT
-
Plasmid#222912PurposeCas9/sgRNA plasmid for targeting NPM2DepositorInsertCas9, NPM2 sgRNA 2 (NPM2 Synthetic, Human)
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF821-sgCIDE-4_U6-sgRNA-EF1a-mNeonGreen
Plasmid#211664PurposeU6-sgRNA-EF1a-mNeonGreenDepositorInsertSpyCas9 and sgCIDE-4 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF821-sgCIDE-8_U6-sgRNA-EF1a-mNeonGreen
Plasmid#211668PurposeU6-sgRNA-EF1a-mNeonGreenDepositorInsertSpyCas9 and sgCIDE-8 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF820-sgCIDE-1_U6-sgRNA-EF1a-mCherry2
Plasmid#211649PurposeU6-sgRNA-EF1a-mCherry2DepositorInsertsgCIDE-1 sgRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF821-sgCIDE-35_U6-sgRNA-EF1a-mNeonGreen
Plasmid#211679PurposeU6-sgRNA-EF1a-mNeonGreenDepositorInsertSpyCas9 and sgCIDE-35 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF821-sgCIDE-3_U6-sgRNA-EF1a-mNeonGreen
Plasmid#211663PurposeU6-sgRNA-EF1a-mNeonGreenDepositorInsertSpyCas9 and sgCIDE-3 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF821-sgCIDE-1_U6-sgRNA-EF1a-mNeonGreen
Plasmid#211661PurposeU6-sgRNA-EF1a-mNeonGreenDepositorInsertSpyCas9 and sgCIDE-1 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF821-sgCIDE-24_U6-sgRNA-EF1a-mNeonGreen
Plasmid#211674PurposeU6-sgRNA-EF1a-mNeonGreenDepositorInsertSpyCas9 and sgCIDE-24 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF821-sgOR2B6-3_U6-sgRNA-EF1a-mNeonGreen
Plasmid#211657PurposeU6-sgRNA-EF1a-mNeonGreenDepositorInsertSpyCas9 and sgOR2B6-3 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF821-sgCIDE-32_U6-sgRNA-EF1a-mNeonGreen
Plasmid#211676PurposeU6-sgRNA-EF1a-mNeonGreenDepositorInsertSpyCas9 and sgCIDE-32 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
hLig4 guide2 in pX458
Plasmid#211536PurposesgRNA-2 against Lig4DepositorAvailable SinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
1114H
Plasmid#200640PurposeAn. gambiae transgenesis plasmid. Expresses gRNAs targeting B2-tubulin, ZPG, and DSXF. Crossing to Cas9 generates sterile malesDepositorInsertgRNA targeting DSXF, ZPG, and B2-tubulin. Actin5c-CFP and Vasa2-EYFP reporters.
UseCRISPRExpressionInsectAvailable SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-AsCpf1-2A-GFP-U6-AAVS1-MAFB-sgRNA
Plasmid#194725Purposebased on (CAGGS-AsCpf1-2A-GFP-U6-sgRNA-cloning vector, Addgene 159281), with guide RNA array targeting both AAVS1 and MAFBDepositorArticleAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
UAS-4x(tRNA::dsarm{sgRNA})
Plasmid#187885PurposeGal4/UAS sgRNA expression targeting dsarmDepositorInsert4 sgRNAs targeting dSarm
Available SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.040
Plasmid#184974PurposeTest effect of extending a1/a2 on ADE2 editing rates in yeastDepositorInsertEco1 editing ncRNA and gRNA, ADE2 P272X, a1/a2 length: 27 v2
ExpressionYeastMutationADE2 donor P272stop, a1/a2 length extended to 27 …PromoterGal7Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.111
Plasmid#184980PurposeTest effect of extending a1/a2 on TRP2 editing rates in yeastDepositorInsertEco1 editing ncRNA and gRNA, TRP2 E64X, a1/a2 length: 27 v1
ExpressionYeastMutationTRP2 donor E64stop, a1/a2 length extended to 27 bpPromoterGal7Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pW402-lenti-sg2-mmItgb1-pEF1s-NLS-mScarlet-I-P2A-BlastR
Plasmid#189951PurposeLentiviral vector to co-express a mouse Itgb1 spsgRNA (sg2-Itgb1) with NLS-mScarlet-IDepositorInsertNLS-mScarlet-I-P2A-BlastR; Itgb1 spsgRNA #2
UseLentiviralExpressionMammalianAvailable SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pW403-lenti-sg3-mmItgb1-pEF1s-NLS-mScarlet-I-P2A-BlastR
Plasmid#189952PurposeLentiviral vector to co-express a mouse Itgb1 spsgRNA (sg3-Itgb1) with NLS-mScarlet-IDepositorInsertNLS-mScarlet-I-P2A-BlastR; Itgb1 spsgRNA #3
UseLentiviralExpressionMammalianAvailable SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.002
Plasmid#184972PurposeExpress -Eco1 ADE2 editing ncRNA and gRNADepositorInsertEco1 editing ncRNA and gRNA, ADE2 P272X, a1/a2 length: 12
ExpressionYeastMutationADE2 donor P272stopPromoterGal7Available SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.110
Plasmid#184979PurposeExpress -Eco1 TRP2 editing ncRNA and gRNADepositorInsertEco1 editing ncRNA and gRNA, TRP2 E64X, a1/a2 length: 12
ExpressionYeastMutationTRP2 donor E64stopPromoterGal7Available SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.039
Plasmid#184973PurposeTest effect of extending a1/a2 on ADE2 editing rates in yeastDepositorInsertEco1 editing ncRNA and gRNA, ADE2 P272X, a1/a2 length: 27 v1
ExpressionYeastMutationADE2 donor P272stop, a1/a2 length extended to 27 …PromoterGal7Available SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ5004_hU6_sgRNA targeting e7
Plasmid#190687PurposesgRNA targeting enhancer 7 of MYCDepositorInsertsgRNA targeting enhancer 7 of MYC
UseCRISPR, Lentiviral, and Synthetic BiologyTagsBFP and PuromycinExpressionMammalianPromoterHuman U6 promoterAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDGO186N-KS3
Plasmid#174303PurposeReplicating plasmid with sgRNA cassette containing a killing spacer #3 targeting the wild type polC gene.DepositorInsertspacer expression cassette
ExpressionBacterialAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMpGE_En03-sgRNA_Target1 (Mpphot)
Plasmid#186726PurposeGateway entry vector for sgRNA (target 1: Mpphot [positive control]). Transient expression of sgRNA (target 1: Mpphot) in plant cells.DepositorInsertsgRNA_Mphot
ExpressionBacterialAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pA-RFP-rG2
Plasmid#188969PurposeIPTG inducible mCherry with sgRNADepositorInsertsmCherry
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
rtTA-sg-CMV152
Plasmid#188485PurposegRNA plasmid with neomycin resistance expressing a single guide RNA targeting cytomegaloviral promoter site 152.DepositorInsertCMV promoter sgRNA
UseCRISPRExpressionMammalianMutationNonePromoterU6Available SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
rtTA-sg-CMV162
Plasmid#188486PurposegRNA plasmid with neomycin resistance expressing a single guide RNA targeting cytomegaloviral promoter site 162.DepositorInsertCMV promoter sgRNA
UseCRISPRExpressionMammalianMutationNonePromoterU6Available SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX458_miR-290-295KO-gRNA3
Plasmid#172711PurposeCas9 with 5' gRNA for paired CRISPR KO of miR-290-295 clusterDepositorInsertmiR-290-295
UseCRISPRAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
TFAP4_BHLH_5-1
Plasmid#185054PurposeDeletion of BHLH domain of mouse TFAP4 in combination with TFAP4_BHLH_3-2DepositorInsertTFAP4_5_1_gRNA (Tcfap4 Mouse)
UseLentiviralAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT004
Plasmid#182714PurposeConstituitvely expressed CasRx crRNA cloning vector, extended 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9342 (pgRNA_XIII-1_NatMX)
Plasmid#161594PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XIII-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
1056H
Plasmid#183135PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii sxl, and 1 gRNA targeting D.suzukii bTub,Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[sxl, bTub]
UseCRISPRExpressionInsectAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
1056K
Plasmid#183137PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii sxl, and 1 gRNA targeting D.suzukii bTub,Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[sxl, bTub]
UseCRISPRExpressionInsectAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSIN-Arkadia-gRNA5
Plasmid#180366Purposetargeting mouse Arkadia geneDepositorAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSIN-Arkadia-gRNA4
Plasmid#180365Purposetargeting mouse Arkadia geneDepositorAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK22 pCAS-Tyr-[gRNA: 5=ARS308] (SplitHygR, AmpR)
Plasmid#179006PurposeSp.Cas9 and gRNA yeast expression vector with ARS308 gRNA pre-cloned. Selection =SplitHygromycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK15 pCAS-Tyr-[gRNA: 5=ARS308] (SplitKanR, AmpR)
Plasmid#178999PurposeSp.Cas9 and gRNA yeast expression vector with ARS308 gRNA pre-cloned. Selection =SplitKanamycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLeGO.sgGata1.4.RUNX1A.iG2
Plasmid#181976Purposegene knock out of mouse GATA1, overexpression of 3xFLAG-RUNX1A (human)DepositorAvailable SinceApril 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-CMV152
Plasmid#179916PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting cytomegaloviral promoter site 152.DepositorInsertCMV promoter sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-CMV162
Plasmid#179917PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting cytomegaloviral promoter site 162.DepositorInsertCMV promoter sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only