We narrowed to 2,557 results for: GCG
-
Plasmid#125767Purposeconstitutive expression of a guide RNA targeting an intergenic region of human chromosome 2 (CRISPR cutting control)DepositorInsertsgCh2-2
UseCRISPRAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
DDR1 gRNA (BRDN0001145659)
Plasmid#78010Purpose3rd generation lentiviral gRNA plasmid targeting human DDR1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CSNK1E gRNA (BRDN0001147706)
Plasmid#77978Purpose3rd generation lentiviral gRNA plasmid targeting human CSNK1EDepositorInsertUseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GCK gRNA (BRDN0001147104)
Plasmid#77583Purpose3rd generation lentiviral gRNA plasmid targeting human GCKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GUCY2D gRNA (BRDN0001146190)
Plasmid#76032Purpose3rd generation lentiviral gRNA plasmid targeting human GUCY2DDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pU6-pegRNA-LRRK2-G2019S-3b
Plasmid#180433PurposeTransiently expressing a pegRNA to introduce LRRK2-G2019S mutation in human cellsDepositorInsertncRNA targeting LRRK2-G2019S (LRRK2 Human)
UseCRISPRExpressionMammalianMutationLRRK2-G2019SPromoterU6AvailabilityAcademic Institutions and Nonprofits only -
pU6-pegRNA-LRRK2-G2019S-3c
Plasmid#180434PurposeTransiently expressing a pegRNA to introduce LRRK2-G2019S mutation in human cellsDepositorInsertncRNA targeting LRRK2-G2019S (LRRK2 Human)
UseCRISPRExpressionMammalianMutationLRRK2-G2019SPromoterU6AvailabilityAcademic Institutions and Nonprofits only -
pU6-pegRNA-LRRK2-G2019S-3d
Plasmid#180435PurposeTransiently expressing a pegRNA to introduce LRRK2-G2019S mutation in human cellsDepositorInsertncRNA targeting LRRK2-G2019S (LRRK2 Human)
UseCRISPRExpressionMammalianMutationLRRK2-G2019SPromoterU6AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgRNA(CTRL)-CMV-eGFP
Plasmid#194017PurposeExpresses a gRNA that targets the LacZ gene (serves as control) and eGFPDepositorInsertssgRNA(CTRL)
eGFP
UseAAV and CRISPRExpressionMammalianPromoterCMVAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
PGL4.11-COL1A1mTEAD
Plasmid#230916PurposeComparing with wild type COL1A1 promoter, tested whether mutant TEAD binding sites changed the promoter activity.DepositorInsertHuman COL1A1 promoter with mutant TEAD elements (COL1A1 Human)
UseLuciferaseTagsLuciferase- luc2pExpressionBacterial and MammalianMutationmutant potential TEAD bind elements AGGAAT to CTG…PromoterCOL1A1Available SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDEST 3xFlag-pcDNA5-FRT/T0-53BP1 28A
Plasmid#52505Purposemammalian expression vector of 53BP1 28A mutantDepositorInsert53BP1 28A (TP53BP1 Human)
TagsFlagExpressionMammalianMutationAll 28 SQ/TQ motifs in N-term of 53BP1 have been …Available SinceApril 10, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
LCV2_PSMD1_sgRNA_1
Plasmid#155091Purposelentiviral plasmid expressing Cas9 and gRNA targeting PSMD1 (core essential gene)DepositorInsertPSMD1_sgRNA_1 (PSMD1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
LCV2_mCherry_PSMD1_sgRNA_1
Plasmid#155107Purposelentiviral plasmid expressing mCherry, Cas9 and a gRNA targeting PSMD1 (core essential gene)DepositorInsertPSMD1_sgRNA_1 (PSMD1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgPlxnb2-CRISPRa-3-EF1a-LibVec
Plasmid#239596Purposeexpresses guide#3 to boost the expression of mouse Plxnb2, via CRISPRaDepositorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgPlxnb2-3 in pT4-U6-sgRNA-CMV-EGFP
Plasmid#239590Purposeexpresses guide#3 to boost the expression of mouse Plxnb2, via CRISPRaDepositorInsertsgRNA targeting TSS-upstream reagion of Plxnb2 (Plxnb2 Mouse)
UseSleeping beauty (sb) transposonExpressionMammalianPromoterhU6Available SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD 3E@3R
Plasmid#188149PurposeExpresses C-terminal flag-tagged human CAD 3E@3R in mammalian cellsDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationTCC -> AGT silent mutations at nt439-441 elimi…Available SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003 UBE2C guide 2
Plasmid#117071Purposesingle guide RNA targeting UBE2C; guide 2DepositorInsertUBCH10 (UBE2C Human)
UseCRISPRAvailable SinceMarch 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
px330 Gatad2a sgRNA (for deletion)
Plasmid#110814PurposeExpressed sgRNA for generating Gatad2a deletion (knockout ) in mouse cell linesDepositorInsertmGataD2a (Gatad2a Mouse)
ExpressionMammalianAvailable SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
HK1 gRNA (BRDN0001146994)
Plasmid#77645Purpose3rd generation lentiviral gRNA plasmid targeting human HK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
hNTa1-qgRNA-pYJA5
Plasmid#217779PurposeNon-targeting control 1 qgRNA-pYJA5 plasmid from the T.gonfio library; it can be used as a ready-to-go control and provides the three constant regions for the three-fragment PCRs for qgRNA cloningDepositorInsertQuadruple sgRNA-expression cassette for nontargeting control for gene activation and epigenetic silencing
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterhuman U6, mouse U6, human H1, human 7SKAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003-sgMYC
Plasmid#125770Purposeconstitutive expression of a guide RNA targeting human MYC (CRISPR positive control)DepositorInsertsgMYC (MYC Human)
UseCRISPRAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 ZFAND3-guide4
Plasmid#125516PurposeCRISPR-mediated activation of ZFAND3. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR.DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a core and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-DIO-SaCas9-U6-sgDaglb
Plasmid#240023PurposeKnockdown expression of DaglbDepositorAvailable SinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 EGFP-guide1
Plasmid#118166PurposeCRISPRa negative control. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR, and sgRNA1 against the EGFP CDSDepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a core and U6Available SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 ZBED3-TSS-guide1
Plasmid#125506PurposeCRISPR-mediated activation of ZBED3. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR.DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a core and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 CRY2-TSS-guide2
Plasmid#125490PurposeCRISPR-mediated activation of CRY2. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR.DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a core and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 TCF7L2 TSS-guide4
Plasmid#118187PurposeCRISPR-mediated activation of TCF7L2. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR.DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a core and U6Available SinceApril 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 TCF7L2 TSS-guide3
Plasmid#118186PurposeCRISPR-mediated activation of TCF7L2. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR.DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a core and U6Available SinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only