We narrowed to 2,224 results for: mt
-
Plasmid#65044PurposeExpresses Catalytically inactive GFP-PRMT7 LDIG(69-72)AAAA mutantDepositorInsertPRMT7 (Prmt7 Mouse)
UseBacterial propagationTagsGFPExpressionMammalianMutationL69A D70A I71A G72APromoterCMVAvailable SinceJuly 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-IB-H2B-HaloTag
Plasmid#247345PurposeExpresses H2B-Halo under CAG promoter and can be randomly integrated by PiggyBac transposaseDepositorAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-IB-H2B-PA-mCherry
Plasmid#247339PurposeExpresses photoactivatable H2B-Cherry under CAG promoter and can be randomly integrated by PiggyBac transposaseDepositorAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO-U6-sgRXRa4-1; EF1a-mScarlet
Plasmid#242889PurposeFor lentiviral Crispr/Cas9 mediated knockout of mouse RXRa, using a guide RNA against exon 4, coupled to EF1a-driven mScarletDepositorInsertsgRNA targeting Rxra
UseCRISPR and LentiviralTagsmScarletExpressionMammalianPromoterU6Available SinceAug. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
mKate2-DrCav1 in pT3TS-Dest
Plasmid#194293PurposeIn vitro transcription of mKate2 tagged zebrafish caveolin1 from the T3 promoter. The red fluorescent tag is at the N-terminus. Parton lab clone KZWDepositorInsertcaveolin (cav1.S Frog)
UseIn vitro transcription of mrnaAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
mKate2-DrCavin1a in pT3TS-Dest
Plasmid#194294PurposeIn vitro transcription of mKate2 tagged zebrafish cavin1a from the T3 promoter. The red fluorescent tag is at the N-terminus. Parton lab clone LAIDepositorInsertcavin1a (cavin1a Zebrafish)
UseIn vitro transcription of mrnaAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
p3E-HsNRF2 (NFE2L2)
Plasmid#194302PurposeMultisite gateway entry clone for expression of human NRF2 (NFE2L2) with fusion tag at the N-terminus. Parton lab clone KRSDepositorInsertNFE2L2 (NFE2L2 Human)
UseMultisite gateway entry vectorAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
p3E-DrCavin1a
Plasmid#194291PurposeMultisite gateway entry clone for expression of codon optimised zebrafish cavin1a with fusion tag at the N-terminus. Parton lab clone KXMDepositorInsertcavin1a (cavin1a Zebrafish)
UseMultisite gateway entry vectorAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
ApoE3_D125I_47-300_mCh-SspB (pBS1071)
Plasmid#185294PurposeFor the mammalian expression of the human protein ApoE3_D125I_47-300 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertApoE3_D125I_47-300
ExpressionMammalianMutationD125IAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
CAHS2_PARRC_98-130_mCh-SspB (pBS1077)
Plasmid#185300PurposeFor the mammalian expression of the tardigrade protein CAHS2_PARRC_98-130 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertCAHS2_PARRC_98-130
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
DSUP_RAMVA_1-208_mCh-SspB (pBS1073)
Plasmid#185296PurposeFor the mammalian expression of the tardigrade protein DSUP_RAMVA_1-208 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertDSUP_RAMVA_1-208
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
ApoE3_47-300_mCh-SspB (pBS1070)
Plasmid#185293PurposeFor the mammalian expression of the human protein ApoE3_47-300 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertApoE3_47-300
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
ApoE4_47-300_mCh-SspB (pBS1069)
Plasmid#185292PurposeFor the mammalian expression of the human protein ApoE4_47-300 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertApoE4_47-300
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
ApoE2_47-300_mCh-SspB (pBS1068)
Plasmid#185291PurposeFor the mammalian expression of the human protein ApoE2_47-300 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertApoE2_47-300
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
-
pLD-puro-Cn-VA-NHEJ1-S263E
Plasmid#141340PurposeLentiviral vector for expression of human NHEJ1-S263E in mammalian cellsDepositorInsertNHEJ1-S263E (NHEJ1 Human)
UseLentiviralTagsVA tag (3XFLAG-2XTEV-6XHis-2XStrep-Beacon)ExpressionMammalianMutationS263EPromoterCMVAvailable SinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cn-VA-NHEJ1-S263A
Plasmid#141341PurposeLentiviral vector for expression of human NHEJ1-S263A in mammalian cellsDepositorInsertNHEJ1-S263A (NHEJ1 Human)
UseLentiviralTagsVA tag (3XFLAG-2XTEV-6XHis-2XStrep-Beacon)ExpressionMammalianMutationS263APromoterCMVAvailable SinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.1 mitoAURKA Lys162Met
Plasmid#157752PurposeExpression of kinase-dead AURKA K62M in mitochondriaDepositorInsertAURKA (AURKA Human)
ExpressionMammalianMutationAURKA K162M is a kinase-dead version of AURKAPromoterCMVAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only