We narrowed to 676 results for: ADH1;
-
Plasmid#121389PurposeFor Yeast-two-hybrid analysisDepositorInsertATG17
ExpressionYeastMutationIsoleucine 310 to Aspartic acidPromoterADH1 promoterAvailable SinceMarch 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGBDU-Atg17(F317D)
Plasmid#121396PurposeFor Yeast-two-hybrid analysisDepositorInsertATG17
ExpressionYeastMutationPhenylalanine 317 to Aspartic acidPromoterADH1 promoterAvailable SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGAD-Atg17(I98E)
Plasmid#121387PurposeFor Yeast-two-hybrid analysisDepositorInsertATG17
ExpressionYeastMutationIsoleucine 98 to Glutamic acidPromoterADH1 promoterAvailable SinceFeb. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
isoform PKC Epsilon (JCE592)
Plasmid#89776Purposeyeast expression of mouse PKC Epsilon with yeast PKC1 promoter and ADH1 terminatorDepositorAvailable SinceMay 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-His3MX6-PGAL1-GST
Plasmid#41613DepositorInsertGAL1 promoter (GAL1 Budding Yeast)
UseYeast genomic targetingTagsA. gossypii translation elongation factor 1a gene…Available SinceDec. 11, 2012AvailabilityAcademic Institutions and Nonprofits only -
pDN0606 (pDEST-DHFR F[3] N-term,HygR)
Plasmid#210488PurposepDEST vector to tag gene of interest with DHFR F[3] on the N-terminus to perform DHFR-PCA in S. cerevisiae.DepositorTypeEmpty backboneUseSynthetic Biology; Destination vector for gateway…ExpressionYeastPromoterADH1Available SinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKB11 (pDEST-DHFR F[1,2] C-term, NatR)
Plasmid#210485PurposepDEST vector to tag gene of interest with DHFR F[1,2] on the C-terminus to perform DHFR-PCA in S. cerevisiae.DepositorTypeEmpty backboneUseSynthetic Biology; Destination vector for gateway…ExpressionYeastPromoterADH1Available SinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEVA1
Plasmid#58953PurposeContains a synthetic DNA sequence, VAR1u, that specifies the Var1 protein. The Cox4 targeting signal is fused to the N-terminus to direct import of Var1. Complements var1 mutations in mtDNA.DepositorInsertVAR1u, VAR1 recoded for expression from the nucleus
UseYeast ecoli shuttle vectorTagspreCox4 mitochondrial matrix targeting signalExpressionYeastMutationSynthetic gene in standard genetic codePromoterADH1Available SinceAug. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pACT2-μ3A
Plasmid#198174PurposeExpression of GAL4 transcriptional activation domain (AD)-AP-3 μ3A fusion protein in yeast (yeast two-hybrid assays)DepositorInsertAP-3 μ3A
TagsGAL4 transcriptional activation domain (AD) fragm…ExpressionYeastMutationsilent substitution in codon 225PromoterADH1Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDN0605 (pDEST-DHFR F[1,2] N-term, NatR)
Plasmid#210487PurposepDEST vector to tag gene of interest with DHFR F[1,2] on the N-terminus to perform DHFR-PCA in S. cerevisiae.DepositorTypeEmpty backboneUseSynthetic Biology; Destination vector for gateway…ExpressionYeastPromoterADH1Available SinceDec. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKB12 (pDEST-DHFR F[3] C-term, HygR)
Plasmid#210486PurposepDEST vector to tag gene of interest with DHFR F[3] on the C-terminus to perform DHFR-PCA in S. cerevisiae.DepositorTypeEmpty backboneUseSynthetic Biology; Destination vector for gateway…ExpressionYeastPromoterADH1Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDN-T2dGZmxh
Plasmid#44552DepositorInsertsPTETREG promoter
yEGFP::ZeoR
UseSynthetic Biology; Expression regulator/reporterExpressionYeastPromoterPTETREGAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pNIA-CEN-Venus-FLAG-LINXa4-Bre1
Plasmid#73618PurposeVisualizing the nuclear translocation of LINXa4-Bre1 in yeast.DepositorInsertVenus
UseSynthetic BiologyTagsFLAGExpressionYeastMutationBre1 point mutations K8A, K9A and K11APromoterADH1Available SinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
YIp211-ADH-CUbo-VSV
Plasmid#212733PurposeConsitutive expression of CUbo-VSV in budding yeastDepositorInsertCUbo
UseIntegrative vectorTagsVSVExpressionYeastPromoterADH1Available SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp128-ADH-CUbo-VSV
Plasmid#212732PurposeConsitutive expression of CUbo-VSV in budding yeastDepositorInsertCUbo
UseIntegrative vectorTagsVSVExpressionYeastPromoterADH1Available SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp211-ADH-NUbo-VSV
Plasmid#212729PurposeConsitutive expression of NUbo-VSV in budding yeastDepositorInsertNUbo
UseIntegrative vectorTagsVSVExpressionYeastPromoterADH1Available SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp128-ADH-NUbo-VSV
Plasmid#212728PurposeConsitutive expression of NUbo-VSV in budding yeastDepositorInsertNUbo
UseIntegrative vectorTagsVSVExpressionYeastPromoterADH1Available SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGBT9-GGA2-GAE
Plasmid#199175PurposeExpression of GAL4 DNA-binding domain (BD)-GGA2-GAE domain fusion protein in yeast (yeast two-hybrid assays)DepositorInsertGGA2-GAE domain (GGA2 Human)
TagsGAL4-DNA binding domain fragmentExpressionYeastMutationContains Lys 545 Gln substitutionPromoterADH1Available SinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGBT9-GGA3-GAE
Plasmid#199176PurposeExpression of GAL4 DNA-binding domain (BD)-GGA3-GAE domain fusion protein in yeast (yeast two-hybrid assays)DepositorInsertGGA3-GAE domain (GGA3 Human)
TagsGAL4-DNA binding domain fragmentExpressionYeastPromoterADH1Available SinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGBT9-γ2 ear
Plasmid#199178PurposeExpression of GAL4 DNA-binding domain (BD)-AP-1 γ2 ear domain fusion protein in yeast (yeast two-hybrid assays)DepositorInsertAP-1 γ2 ear domain (AP1G2 Human)
TagsGAL4-DNA binding domain fragmentExpressionYeastPromoterADH1Available SinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGBT9-GGA1-GAE
Plasmid#199174PurposeExpression of GAL4 DNA-binding domain (BD)-GGA1-GAE domain fusion protein in yeast (yeast two-hybrid assays)DepositorInsertGGA1-GAE domain (GGA1 Human)
TagsGAL4-DNA binding domain fragmentExpressionYeastPromoterADH1Available SinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pACT2-μ1B (137-423)
Plasmid#198172PurposeExpression of GAL4 transcriptional activation domain (AD)-AP-1 μ1B (137-423) fusion protein in yeast (yeast two-hybrid assays)DepositorInsertAP-1 μ1B (137-423)
TagsGAL4 transcriptional activation domain (AD) fragm…ExpressionYeastPromoterADH1Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGBT9-AAGAB
Plasmid#198332PurposeExpression of GAL4 DNA-binding domain (BD)-AAGAB fusion protein in yeast (yeast two-hybrid assays)DepositorInsertAAGAB (AAGAB Human)
TagsGAL4-DNA binding domain (BD) fragmentExpressionYeastPromoterADH1Available SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGAD-Atg17(L313D I314K)
Plasmid#121390PurposeFor Yeast-two-hybrid analysisDepositorInsertATG17
ExpressionYeastMutationLeucine 313 to Aspartic acid; Isoleucine 314 to L…PromoterADH1 promoterAvailable SinceMarch 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNIA-CEN-FLAG-LINXa4-Bre1
Plasmid#73617PurposeControl of the E3 ligase Bre1 with LINXa in yeast.DepositorInsertLINXa4-Bre1dNLS
UseSynthetic BiologyTagsFLAGExpressionYeastMutationBre1 point mutations K8A, K9A and K11APromoterADH1Available SinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHES839
Plasmid#87941PurposeConstitutively expresses estradiol-inducible synthetic transcriptional regulator in yeast. Transcriptional regulator activates transcription of promoters containing Gal4 binding sites.DepositorInsertGAL4 DBD - hER LBD - MSN2 AD (ESR1 Synthetic, Human, Budding Yeast)
UseSynthetic BiologyExpressionYeastPromoterADH1 (crippled)Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHES795
Plasmid#87943PurposeConstitutively expresses estradiol-inducible synthetic transcription factor in yeast. It activates transcription of promoters containing Zif268 binding sites.DepositorInsertZif268 DBD - hER LBD - MSN2 AD (ESR1 Synthetic, Human, Budding Yeast)
ExpressionYeastPromoterADH1 (crippled)Available SinceJan. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTH727-CEN-RLuc/staCFLuc
Plasmid#38211DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationThe last three codons of the full-length Firefly …PromoterADH1 and TDH3 (=GPD)Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pGBT9-Hook2
Plasmid#198524PurposeExpression of GAL4 DNA-binding domain (BD)-Hook2 fusion protein in yeast (yeast two-hybrid assays)DepositorInsertHook2 (HOOK2 Human)
TagsGAL4-DNA binding domain fragmentExpressionYeastMutationHis488Gln substitutionPromoterADH1Available SinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTH743-CEN-RLuc/slowstaCFLuc
Plasmid#38223DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationThe last three codons of the full-length Firefly …PromoterADH1 and TDH3 (=GPD)Available SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
YIp211-ADH-NUbo-E3(63)-VSV
Plasmid#212751PurposeConstitutive expression of NUbo-E3(63)-VSV in budding yeastDepositorInsertE3(63)
UseIntegrative vectorTagsNUbo and VSVExpressionYeastPromoterADH1Available SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp128-ADH-NUbo-E3(63)-VSV
Plasmid#212750PurposeConstitutive expression of NUbo-E3(63)-VSV in budding yeastDepositorInsertE3(63)
UseIntegrative vectorTagsNUbo and VSVExpressionYeastPromoterADH1Available SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp211-ADH-NUbo-E3(48)-VSV
Plasmid#212742PurposeConsitutive expression of NUbo-E3(48)-VSV in budding yeastDepositorInsertE3(48)
UseIntegrative vectorTagsNUbo and VSVExpressionYeastPromoterADH1Available SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp128-ADH-NUbo-E3(48)-VSV
Plasmid#212741PurposeConsitutive expression of NUbo-E3(48)-VSV in budding yeastDepositorInsertE3(48)
UseIntegrative vectorTagsVSVExpressionYeastPromoterADH1Available SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp128-ADH-CUbo-mCherry-VSV
Plasmid#212734PurposeConsitutive expression of CUbo-mCherry-VSV in budding yeastDepositorInsertCUbo
UseIntegrative vectorTagsmCherry-VSVExpressionYeastPromoterADH1Available SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIp128-ADH-NUbo-mCherry-VSV
Plasmid#212731PurposeConsitutive expression of NUbo-mCherry-VSV in budding yeastDepositorInsertNUbo
UseIntegrative vectorTagsmCherry-VSVExpressionYeastPromoterADH1Available SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGBT9-γ1 ear
Plasmid#199177PurposeExpression of GAL4 DNA-binding domain (BD)-AP-1 γ1 ear domain fusion protein in yeast (yeast two-hybrid assays)DepositorInsertAP-1 γ1 ear domain (Ap1g1 Mouse)
TagsGAL4-DNA binding domain fragmentExpressionYeastPromoterADH1Available SinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGAD424-Rabex-5
Plasmid#197043PurposeExpression of GAL4 transcriptional activation domain (AD)-Rabex-5 fusion protein in yeast (yeast two-hybrid assays)DepositorInsertRabex-5 (RABGEF1 Bovine)
TagsGAL4 transcriptional activation domain (AD) fragm…ExpressionYeastPromoterADH1Available SinceMarch 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGAD-hRubicon
Plasmid#64144PurposeFor yeast two hybridDepositorAvailable SinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only