We narrowed to 21,997 results for: lentiviral
-
Plasmid#136691PurposeInducible Gli2 shRNA lentiviral plasmid (target sequence: human GLI2 5′CCGGCCTGGCATGACTACCACTATGCTCGAGCATAGTGGTAGTCATGCCAGGTTTTTG 3′)DepositorInsertshRNA_humanGli2 (GLI2 Human)
UseLentiviralAvailable SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
NgΔIQ FUNgDIQGW
Plasmid#92232PurposeLentiviral expression of human Ng with deletion mutationDepositorInsertNg (NRGN Human)
UseLentiviralTagsEGFPExpressionMammalianMutationdelta IQPromoterhUbCAvailable SinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7751 pHR Ef1α: mCherry-P2A-AcrIIA4
Plasmid#125148PurposeLentiviral vector for constitutive expression of AcrIIA4 with mCherry fluorescent reporter.DepositorInsertAcrIIA4-P2A-mCherry
UseCRISPR and LentiviralExpressionMammalianAvailable SinceMay 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
TFORF3483
Plasmid#144959PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSin-GFP-Fg
Plasmid#174307PurposeLentiviral expression of GFPDepositorAvailable SinceSept. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mCherry
Plasmid#209035PurposeLentiviral backbone for expressing U6 driven hybrid guide (hg)RNAs with BveI cloning sites, mCherry and puromycin selection markerDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
TFORF2676
Plasmid#142355PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-mTurquoise-MLC-IRES-neo
Plasmid#85145Purposelentiviral expression of myosin light chain (MLC, MYL9), N-terminally tagged with mTurquoiseDepositorInsertmTurquoise-MLC (myosin regulatory light chain, N-terminally tagged with mTurquoise (MYL9 Human)
UseLentiviralTagsmTurquoisePromoterEF1aAvailable SinceFeb. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
TFORF0672
Plasmid#141658PurposeLentiviral vector for overexpressing the ZNF827 transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
MLKL gRNA (BRDN0001148608)
Plasmid#77539Purpose3rd generation lentiviral gRNA plasmid targeting human MLKLDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcsII-pb2-flag
Plasmid#86766PurposeC-terminal flag-tagged protein expression in mammalian cells, lentiviral vectorDepositorInsertproteasome beta subunit 2 (PSMB2 Human)
UseLentiviralTagsflagExpressionMammalianPromoterEF-1aAvailable SinceJan. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
MLKL gRNA (BRDN0001146456)
Plasmid#77540Purpose3rd generation lentiviral gRNA plasmid targeting human MLKLDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pOUPc-UL148-mCherry
Plasmid#179279PurposeAll in one "tet-on" lentivirus vector that expresses human cytomegalovirus UL148 fused to an mCherry tag at its cytoplasmic tail. UL148 reorganizes the ER and activates the UPR.DepositorInsertUL148 fused to mCherry
UseLentiviral; Tet-on, all-in-one lentiviral vectorTagsmCherryExpressionMammalianPromoterTet responsive element 3GAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF2650
Plasmid#142349PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
TFORF1418
Plasmid#143803PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLX317-hcRED
Plasmid#115440PurposeConstitutive lentiviral expressionDepositorInserthcRED
UseLentiviralTagsV5ExpressionMammalianPromoterEF1aAvailable SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
LV_EF1a_CDK1(T14A,Y15F)-P2A-Hygro_Barcode
Plasmid#170220PurposeBarcoded lentiviral vector to express CDK1 (T14A, Y15F) in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seqDepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
TFORF0627
Plasmid#143231PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF1436
Plasmid#143499PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceSept. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001146145)
Plasmid#80198Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
TFORF0224
Plasmid#142364PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTet-O-E2F7-T2A-PuroR
Plasmid#162348PurposeLentiviral expression of E2F7 under the control of the TetON promoterDepositorAvailable SinceFeb. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
TFORF1723
Plasmid#143152PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF2273
Plasmid#143360PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF1508
Plasmid#143817PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF2426
Plasmid#144022PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF1656
Plasmid#141861PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
PPP6C_pLX307
Plasmid#98360PurposeLentiviral expression of PPP6CDepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
TFORF0200
Plasmid#141552PurposeLentiviral vector for overexpressing the RFX3 transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
PPIE_pLX307
Plasmid#98361PurposeLentiviral expression of PPIEDepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
STK11 gRNA (BRDN0001147319)
Plasmid#75914Purpose3rd generation lentiviral gRNA plasmid targeting human STK11DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-Cherry-AnillinFL
Plasmid#187271PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin full lengthDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryPromoterU6, CMVAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0-Anillin shRNA
Plasmid#187270PurposeLentiviral expression of shRNA targeting AnillinDepositorAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1_SDHA
Plasmid#177980Purposelentiviral vector expressing Cas9 and a sgRNA targeting SDHADepositorInsertsgRNA targeting SDHA (SDHA Human)
UseLentiviralExpressionMammalianMutationN/APromoterU6Available SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO-RFP-IKZF1-sh2
Plasmid#69041Purpose3rd generation lentiviral vector expressing IKZF1 shRNADepositorAvailable SinceOct. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
TFORF1584
Plasmid#144106PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF1498
Plasmid#142806PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
TFORF1469
Plasmid#142800PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
TFORF2570
Plasmid#142122PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
TFORF2452
Plasmid#142945PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF1568
Plasmid#143962PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
MLKL gRNA (BRDN0001149268)
Plasmid#77541Purpose3rd generation lentiviral gRNA plasmid targeting human MLKLDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TFORF3125
Plasmid#144601PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF2482
Plasmid#142103PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF1862
Plasmid#142877PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceApril 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRRLSIN.cPPT.PGK.MD(ND2bHLH).WPRE
Plasmid#122055PurposeLentiviral expression of a MyoD chimeric protein substituted with the NeuroD2 bHLH domainDepositorUseLentiviralExpressionMammalianMutationMyoD chimeric protein substituted with the NeuroD…Available SinceMarch 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
TFORF2666
Plasmid#142970PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-GG-hUBC-EBFP2
Plasmid#212314PurposeLentiviral backbone with EBFP2 reporterDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceJune 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
EF1a_LHX3_P2A_Hygro_Barcode
Plasmid#120456PurposeBarcoded lentiviral vector to express LHX3 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
TFORF1982
Plasmid#142901PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only