We narrowed to 7,096 results for: cas9 plasmid
-
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML107-ZIM17
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-RB-PE2
Plasmid#173902PurposeSB-transposon with constitutive expression of SpCas9 PE2DepositorInsertPE2
UseCRISPRTagsSV40 NLSExpressionMammalianAvailable SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
HCP1
Plasmid#166103PurposeThis plasmid encodes a Cas9 protein as well as a sgRNA that targets Msn2, which will create a double strand break and allow C-terminus tagging via homologous recombination.DepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pST_116_LVL2 cam
Plasmid#179332PurposeNT-CRISPR plasmid for a single gRNA.DepositorInsertPtac tfoX, Ptet cas9, PJ23106 acrIIA4, Ptet gRNA with sfGFP dropout
UseCRISPRAvailable SinceMarch 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_119_LVL2 cam
Plasmid#179333PurposeNT-CRISPR plasmid for integration of multiple gRNAs.DepositorInsertPtac tfoX, Ptet cas9, PJ23106 acrIIA4, sfGFP dropout to be replaced with gRNAs
UseCRISPRAvailable SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEG302 22aa SunTag NtDRMcd (no NLS) g4+g10+g18 (FWA)
Plasmid#117168PurposeCRISPR Cas9 SunTag system to target NtDRMcd (without an NLS) to the FWA locus with three guide RNAsDepositorInsertg18_U6_g10_U6_g4_U6_NOS_NLS_GB1_noNLS_linker_DRMcd_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
eGFPbait-E2A-KalTA4-pA donor vector
Plasmid#61069Purposefor CRISPR/Cas9 mediated insertion of E2A-KalTA4; to be used in combination with a eGFP specific sgRNA (e.g. Plasmid 61051)DepositorInsertseGFPbait
KalTA4
UseZebrafish expressionTagsE2AAvailable SinceFeb. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLC133
Plasmid#198639PurposeExpression plasmid for dCas9 in E. coli used in Chip-seq experiments. dCas9 is tagged with a C-terminal 3x FLAG tag. A guide RNA can be cloned using BsaI restriction sites.DepositorInsertdCas9
Tags3x-FLAGExpressionBacterialPromoterpTetAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHRdSV40_scFv_GCN4_sfGFP-VPR-GB1_NLS
Plasmid#79373PurposeRecruits VPR to a compatible Cas9 protein for transcriptional activationDepositorInsertGCN4-sfGFP-VPR
UseCRISPRExpressionMammalianAvailable SinceOct. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHRdSV40_scFv_GCN4_sfGFP_p65-hsf1_GB1_NLS
Plasmid#79372PurposeRecruits p65-hsf1 to a compatible Cas9 protein for transcriptional activationDepositorInsertGCN4-sfGFP-p65-hsf1
UseCRISPRExpressionMammalianAvailable SinceMarch 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
MSP2283
Plasmid#70702PurposeBacterial expression plasmid for SaCas9 & sgRNA targeted to site 1: T7-humanSaCas9-NLS-3xFLAG-T7-Sa-sgRNA(84) #1DepositorInsertsmammalian codon-optimized Staphylococcus aureus Cas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialPromoterT7Available SinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
MSP2266
Plasmid#70705PurposeBacterial expression plasmid for SaCas9 & sgRNA targeted to site 2: T7-humanSaCas9-NLS-3xFLAG-T7-Sa-sgRNA(84) #2DepositorInsertsmammalian codon-optimized Staphylococcus aureus Cas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialPromoterT7Available SinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only