-
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorInsertARB1 gRNA (ARB1 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorInsertRER2 gRNA (RER2 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorInsertLEU2 gRNA (RER2 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorInsertURA3 gRNA (URA3 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorInsertURA3 gRNA (URA3 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorInsertAVO1 gRNA (AVO1 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorInsertYFR054C gRNA (YFR054C Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ZIM17
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorInsertZIM17 gRNA (ZIM17 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorInsertSRP14 gRNA (SRP14 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorInsertTLG1 gRNA (TLG1 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorInsertVHT1 gRNA (VHT1 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorInsertADE13 gRNA (ADE13 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorInsertLAS17 gRNA (LAS17 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorInsertLEU2 gRNA (LEU2 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorInsertINO80 gRNA (INO80 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-RB-PE2
Plasmid#173902PurposeSB-transposon with constitutive expression of SpCas9 PE2DepositorInsertPE2
UseCRISPRTagsSV40 NLSExpressionMammalianMutationPromoterAvailable sinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
HCP1
Plasmid#166103PurposeThis plasmid encodes a Cas9 protein as well as a sgRNA that targets Msn2, which will create a double strand break and allow C-terminus tagging via homologous recombination.DepositorInsertMsn2-sgRNA#27 (MSN2 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
5xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7, SMAD4 exon 9 probasin_mTQ2_FlpO
Plasmid#68357PurposeThe prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex7 and 8, and SMAD4 ex2 and ex 9 are expressed by the U6 promoter.DepositorInserts5xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7, SMAD4 exon 9
FlpO recombinase
UseCRISPRTagsmTurquoise2 (BFP)ExpressionMammalianMutationPromoterU6 and synthetic Probasin ARRx2Available sinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMTF1.1.0-gDNA
Plasmid#113797PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor MTF1DepositorInsertMTF1 (MTF1 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZBTB9.1.0-gDNA
Plasmid#112469PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZBTB9DepositorInsertZBTB9 (ZBTB9 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only