We narrowed to 5,049 results for: Mos
-
Plasmid#224534PurposeA Gateway compatible 3' entry clone containing an Actin nanobody fused to mNeonGreen with a c-terminal HA tagDepositorInsertActin-Vhh-mNeonGreen-HA
UseGateway cloningAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
p5E 5X C120 c-fos min pro (JDW 1241)
Plasmid#224544PurposeA Gateway compatible 5' entry clone containing 5 TAEL transcription factor binding sites and a minimal c-Fos promoterDepositorInsert5x-C120-c-Fos promoter
UseGateway cloningAvailable SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAG426GAL-ccdB-mRuby3
Plasmid#166142PurposeGateway destination vector for generation of Galactose-inductibe, C-terminal mRuby3-tagged proteins in yeast. Contains a 2um element for high copy number when in yeast.DepositorTypeEmpty backboneTagsmRuby3ExpressionYeastAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pegRNA entry vector - pUC19-U6-[BsmBI_entry]-term (MNW320)
Plasmid#208977PurposeEntry vector for human U6 promoter driven SpCas9-based pegRNAs, comprised of hU6-[BsmBI]-terminator (spacer and RTT/PBS oligos must be cloned in)DepositorInsertpUC19-U6-[BsmBI]-term (pegRNA_entry_vector)
UseCRISPRTagsBPNLSExpressionMammalianPromoterhuman U6Available SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
Recruited polymerase expression - pCMV-T7-B103-CC(N5) (LM2946)
Plasmid#208974PurposeRecruited B103 DNA polymerase with a C-terminal N5 coiled coil (CC) domain, expressed from CMV or T7 promoters.DepositorInsertB103-BPNLS-CC(N5)
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianPromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
Recruited polymerase expression - pCMV-T7-Phi29-CC(N5) (LM2726)
Plasmid#208971PurposeRecruited Phi29 DNA polymerase (-exo) with a C-terminal N5 coiled coil (CC) domain, expressed from CMV or T7 promoters.DepositorInsertPhi29-BPNLS-CC(N5)
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationPhi29(-exo;D169A)PromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
Recruited polymerase expression - pCMV-T7-Phi29(+exo)-CC(N5) (LM2761)
Plasmid#208970PurposeRecruited Phi29(+exo) DNA polymerase with a C-terminal N5 coiled coil (CC) domain, expressed from CMV or T7 promoters.DepositorInsertPhi29(+exo)-BPNLS-CC(N5)
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianPromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
hPCNA-C148S
Plasmid#190939Purposeuntagged human PCNA with a cysteine to serine mutationDepositorInsertProliferating Cell Nuclear Antigen (PCNA Human)
ExpressionBacterialMutationchanged cysteine 148 to serinePromoterT7Available SinceMarch 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRRL.SIN.EF1A.JAG1-F1.GS.CAR-3G
Plasmid#194462PurposeCAR featuring: GMCSF (sig. peptide); CD8A & CD8A (hinge & TM); CD28, 4-1BB & CD3ζ (signaling domains); anti-JAG1 from J1.F1 in VH-VL order & (GGGGS)3 linker (scFv). GFP-Zeo for selection & monitoring.DepositorInsertAnti-JAG1 CAR
UseLentiviralAvailable SinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRRL.SIN.EF1A.JAG1-F1.218.CAR-3G
Plasmid#194460PurposeCAR featuring: GMCSF (sig. peptide); CD8A & CD8A (hinge & TM); CD28, 4-1BB & CD3ζ (signaling domains); anti-JAG1 from J1.F1 in VL-VH order and 218 linker (scFv). GFP-Zeo for selection and monitoring.DepositorInsertAnti-JAG1 CAR
UseLentiviralAvailable SinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
fru-T2A-QF2 HDR plasmid
Plasmid#141099PurposePlasmid for CRISPR-generated knock-in line that expresses a QF2 transcriptional activator by knocking-in a T2A-QF2 fragment into the coding sequence of the endogenous Aedes aegypti fru geneDepositorInsertfru-left-HDR-arm; T2A-QF2-hsp70; 3xP3-dsRed-SV40; fru-right-HDR-arm
UseDonor templateAvailable SinceAug. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2z-lmo2
Plasmid#164657Purposefor the synthesis of zebrafish lmo2 mRNADepositorAvailable SinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
ETS2_pLENTI-CAG-IRES-GFP
Plasmid#177005PurposeMammalian lentiviral expression vector encoding ETS2DepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
CYYR1_pcDNA6.2/EmGFP-Bsd
Plasmid#176986PurposeMammalian expression vector encoding CYYR1 and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
CBR3_pcDNA6.2/EmGFP-Bsd
Plasmid#176961PurposeMammalian expression vector encoding CBR3 and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
CLDN8_pcDNA6.2/EmGFP-Bsd
Plasmid#176963PurposeMammalian expression vector encoding CLDN8 and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
FAM207A_pcDNA6.2/EmGFP-Bsd
Plasmid#176950PurposeMammalian expression vector encoding FAM207A and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
CPH3400 (YCp LEU2 Rpb1 A1529_G1534delInsLEVLFQGP)
Plasmid#91806PurposeYeast expression of S. cerevisiae Rpb1 with an internal PreScission protease siteDepositorInsertRPO21 (RPO21 Budding Yeast)
ExpressionYeastMutationResidues A1529-G1534 replaced with a PreScission …PromoterEndogenous Rpb1 promoterAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3477 (YCp LEU2 Rpb1 P1455_E1456InsLEVLFQGP)
Plasmid#91807PurposeYeast expression of S. cerevisiae Rpb1 with an internal PreScission protease siteDepositorInsertRPO21 (RPO21 Budding Yeast)
ExpressionYeastMutationPreScission Protease site (LEVLFQGP) inserted bet…PromoterEndogenous Rpb1 promoterAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3506 (pET151_Spt6 1247-1451 K1355A,K1435A)
Plasmid#91818PurposeBacterial expression of residues 1247-1451 from S. cerevisiae Spt6 with K1435A and K1355A mutationsDepositorInsertSPT6 (SPT6 Budding Yeast)
Tags6xHisExpressionBacterialMutationchanged lysine 1355 and lysine 1435 to alanines; …PromoterT7Available SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-HLA-A2-VN (G112P)
Plasmid#135496PurposeMammalian expression of VN-fused and myc-tagged HLA-A*02:01 (G112P mutant)DepositorInsertHLA-A*02:01 (HLA-A Human)
TagsExtracellular c-myc epitope tag, Signal peptide f…ExpressionMammalianMutationG112PPromoterCMVAvailable SinceApril 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-HLA-A2-VN (L156P)
Plasmid#135497PurposeMammalian expression of VN-fused and myc-tagged HLA-A*02:01 (L156P mutant)DepositorInsertHLA-A*02:01 (HLA-A Human)
TagsExtracellular c-myc epitope tag, Signal peptide f…ExpressionMammalianMutationL156PPromoterCMVAvailable SinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-H2-Dd-VN (Y84C/C121S/A139C)
Plasmid#135501PurposeMammalian expression of VN-fused and myc-tagged H2-Dd (Y84C/C121S/A139C mutant)DepositorInsertH2-Dd (H2-D1 Mouse)
TagsExtracellular c-myc epitope tag, Signal peptide f…ExpressionMammalianMutationY84C/C121S/A139CPromoterCMVAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-HLA-A2-VN (I52P)
Plasmid#135486PurposeMammalian expression of VN-fused and myc-tagged HLA-A*02:01 (I52P mutant)DepositorInsertHLA-A*02:01 (HLA-A Human)
TagsExtracellular c-myc epitope tag, Signal peptide f…ExpressionMammalianMutationI52PPromoterCMVAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-HLA-A2-VN (Y59P)
Plasmid#135492PurposeMammalian expression of VN-fused and myc-tagged HLA-A*02:01 (Y59P mutant)DepositorInsertHLA-A*02:01 (HLA-A Human)
TagsExtracellular c-myc epitope tag, Signal peptide f…ExpressionMammalianMutationY59PPromoterCMVAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-HLA-A2-VN (D61P)
Plasmid#135493PurposeMammalian expression of VN-fused and myc-tagged HLA-A*02:01 (D61P mutant)DepositorInsertHLA-A*02:01 (HLA-A Human)
TagsExtracellular c-myc epitope tag, Signal peptide f…ExpressionMammalianMutationD61PPromoterCMVAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-HLA-A2-VN (V67P)
Plasmid#135494PurposeMammalian expression of VN-fused and myc-tagged HLA-A*02:01 (V67P mutant)DepositorInsertHLA-A*02:01 (HLA-A Human)
TagsExtracellular c-myc epitope tag, Signal peptide f…ExpressionMammalianMutationV67PPromoterCMVAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-HLA-A2-VN (Y84P)
Plasmid#135495PurposeMammalian expression of VN-fused and myc-tagged HLA-A*02:01 (Y84P mutant)DepositorInsertHLA-A*02:01 (HLA-A Human)
TagsExtracellular c-myc epitope tag, Signal peptide f…ExpressionMammalianMutationY84PPromoterCMVAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-HLA-A2-VN (E166P)
Plasmid#135498PurposeMammalian expression of VN-fused and myc-tagged HLA-A*02:01 (E166P mutant)DepositorInsertHLA-A*02:01 (HLA-A Human)
TagsExtracellular c-myc epitope tag, Signal peptide f…ExpressionMammalianMutationE166PPromoterCMVAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
GFP-AuroraB L154A/H250Y
Plasmid#108491Purposeexpression of EGFP-AuroraB Analog sensitive (L154A/H250Y)DepositorInsertAuroraB (AURKB Human)
TagsEGFPExpressionMammalianMutationAnalog sensitive L154A/H250YPromoterCMVAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCR3-vsv-INCENP d543-746
Plasmid#108473Purposeexpression of vsv-INCENP d543-746DepositorInsertINCENP d543-746 AA (INCENP Human)
TagsVSVExpressionMammalianMutationDelta Alpha helix, aa543-746 deletedPromoterCMVAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1 hSlp4-a I18A
Plasmid#40043DepositorInserthSlp4-a I18A (SYTL4 Human)
TagsEGFPExpressionMammalianMutationIsoleucine 18 to AlaninePromoterCMV promoterAvailable SinceOct. 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1 hSlp4-a linker
Plasmid#40040DepositorInserthSlp4-a linker (SYTL4 Human)
TagsEGFPExpressionMammalianMutationlinker domain (144-353)PromotercmvAvailable SinceOct. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
Cre-IRES-PuroR
Plasmid#30205PurposeLentiviral coexpression of Cre and puromycin from the human EF1a promoterDepositorInsertCre recombinase (cre Enterobacteria phage P1)
UseCre/Lox and LentiviralExpressionMammalianPromoterEF1alphaAvailable SinceApril 12, 2012AvailabilityAcademic Institutions and Nonprofits only -
GLI1_pLENTI-CAG-IRES-GFP
Plasmid#176992PurposeMammalian lentiviral expression vector encoding GLI1DepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLVX-TetOne-Puro-p21
Plasmid#171122PurposeDoxycycline inducible expression of p21DepositorAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-EF1a-Zim3-dCas9-loxP-P2A-EGFP-loxP
Plasmid#188773PurposedCas9 with an N-term Zim3 KRAB-NLS fusion, a C-term HA-2xNLSDepositorInsertZim3-dCas9
UseLentiviralTagsHA-2xNLS and Zim3 KRAB-NLS fusionPromoterEF1aAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
BACE2_pcDNA6.2/EmGFP-Bsd
Plasmid#176942PurposeMammalian expression vector encoding BACE2 and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
5` CC: Puro – loxP – GFP-C
Plasmid#219563Purpose5` circularization cassette.Used in combination with one of the 3' circularization cassettes to induce Cre-mediated circularizazion or inversion of a desired genomic region.DepositorInserthPGK-promoter_PuroR_2A_loxP_GFP-C
UseUnspecifiedPromoterhPGKAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only