We narrowed to 14,061 results for: CAN
-
Plasmid#111877PurposeThis plasmid expresses Venus fluorescent protein fused to endogenous Histone H2B (H2B) gene of Capsaspora (CAOG_01818). It can be used to transfect Capsaspora cells and visualize nucleus in vivo.DepositorInsertCapsaspora Histone H2B (CoH2B) fused to Venus
UseCapsaspora owczarzakiTagsVenusPromoterElongation Factor 1 alpha (EF1a) from CapsasporaAvailable SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAGGS-Flex-Turbo/GFP
Plasmid#197886PurposeCan be used to generate AAV virus that will express Turbo/GFP in the presence of CreDepositorInsertTurbo/GFP
UseAAVMutationN/APromoterCAGAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBlastR-MCS-QF-MiniWhite
Plasmid#165906PurposeBlasticidin resistant QF driver vector with Mini-white CDS eye marker. Contains an enhancer grammar GB20 entry point for custom enhancers. Standard cut-and-paste cloning can also be used. Vector uses Purple-White bacteria colony screening for identification of correct cloningDepositorInsertSelectable Empty Enhancer Driver
UseSynthetic BiologyAvailable SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMS4 (Empty insertion vector with SEC)
Plasmid#154837PurposeVector that can be modified to add gene(s) of interest to C. elegans ChrII:8420157 site via CRISPR with SEC selectionDepositorInsertSEC
UseCRISPR and Cre/LoxExpressionWormMutationsqt-1(e1350)Available SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pG418R-MCS-QF-MiniWhite
Plasmid#165902PurposeG418 resistant QF driver vector with Mini-white CDS eye marker. Contains an enhancer grammar GB20 entry point for custom enhancers. Standard cut-and-paste cloning can also be used. Vector uses Purple-White bacteria colony screening for identification of correct cloningDepositorInsertSelectable Empty Enhancer Driver
UseSynthetic BiologyAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTXB1-xlH2B(1-114)_K114A
Plasmid#118217PurposeBacterial expression plasmid encoding X. laevis H2B residues 1-114(K114A) as a chimeric fusion to GyrA intein with chitin binding domain at the C-terminus. H2B fragment can be derivatized using MESNa.DepositorInsertxlH2B(1-114)
TagsMxe-GyrA intein fused to chitin binding domainExpressionBacterialMutationLysine 114 to alaninePromoterT7Available SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-rap1-K462-463-651R
Plasmid#84564PurposeThis plasmid can be used as a donor for subcloning into Gateway destination vectors.DepositorAvailable SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-rap1-K43-117-118R
Plasmid#84565PurposeThis plasmid can be used as a donor for subcloning into Gateway destination vectors.DepositorAvailable SinceOct. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pANC98c(3xFLAG-NES-FRB-(G4S)4-cTEV(219)-IRES-EBFP)
Plasmid#248359PurposeLentiviral vector that can express FRB along with a truncated C terminal split TEV. Expressed off of CMV tet ON promoter with EBFP markerDepositorInsert3xFLAG-NES-FRB-(G4S)4x-cTEV(219)
UseLentiviralPromotertight TREAvailable SinceJan. 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
JARID1D-HE-AA
Plasmid#242617PurposeExpresses catalytic mutant JARID1DDepositorAvailable SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pQβEP1
Plasmid#210859PurposeExpress phage Qβ with SARS-CoV Spike protein epitope 1 displayed on the surface that can bind anti-S antibodies under T7 promotorDepositorAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pQβEP3
Plasmid#210861PurposeExpress phage Qβ with SARS-CoV Spike protein epitope 3 displayed on the surface that can bind anti-S antibodies under T7 promotorDepositorAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
huCofilin S3E SSR
Plasmid#245940PurposeExpresses human cofilin with mutation S3E that behaves like inactive phosphocofilin but can be dominant negative against phosphataseDepositorInsertcofilin 1 (cfl1) (CFL1 Human)
ExpressionMammalianMutationS3E; silent mutations (NTs 67 to 75) in which TCT…PromoterCMVAvailable SinceOct. 21, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pFNC-5
Plasmid#233297PurposePlasmid encoding the BxbI phage integrase. It can be used to remove the antibiotic resistance cassette integrated with pCIFR. TcR, easily curable via sucrose counterselection.DepositorInsertsBxbI phage integrase
sacB
ExpressionBacterialPromoterPEM7 and unknownAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas3-APOBEC1
Plasmid#229536PurposepMV_hyg encoding Cas3(wt)-rAPOBEC1 fusion construct and crRNA expression cassette. Respective crRNA spacer can be introduced via BsmBI restriction cloningDepositorInsertsrAPOBEC1
Cas3
Uracil glycosylase inhibitor
TagsXTENExpressionBacterial and YeastMutationcodon optimized for S.cerevisiae and codon optimi…Available SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFNC-6
Plasmid#227669PurposePlasmid encoding the BxbI phage integrase. It can be used to remove the antibiotic resistance cassette integrated with pCIFR. GmR, easily curable via sucrose counterselection.DepositorInsertsBxbI phage integrase
sacB
ExpressionBacterialPromoterPEM7Available SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas3-CDA1
Plasmid#229534PurposepMV_hyg encoding Cas3(wt)-CDA1 fusion construct and crRNA expression cassette. Respective crRNA spacer can be introduced via BsmBI restriction cloningDepositorInsertsCas3
Cytidine deaminase
Uracil glycosylase inhibitor
TagsXTENExpressionBacterial and YeastMutationcodon optimized for S.cerevisiae and codon optimi…Available SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
LLP792_L2_FRT-OCS-tGFP_Red_mCherry_HSP-FlpO
Plasmid#192382PurposeTo test if a single plasmid stably transformed into Arabidopsis can switched from off to on when heat shocked.DepositorInsertAct2::B3RT-OCS-B3RT::Act2::FRT-OCS-FRT::Turbo GFP
UseSynthetic BiologyTagsN7ExpressionPlantAvailable SinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP734_L2pV1_1I_OCS-rLUC_F-NOS-FlpO
Plasmid#192377PurposeTo test if the NOS promoter can drive the Flp recomhinase in order to remove the OCS terminator and increase circuit output.DepositorInsertAct2::FRT-OCS-FRT::Rluc
UseSynthetic BiologyTagsPESTExpressionPlantAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only