We narrowed to 7,531 results for: ski
-
Plasmid#158632PurposeGateway entry vector for an inducible 3xFLAG-tagged MAVS mutantDepositorAvailable SinceSept. 23, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pEN_TT 3xFLAG-MAVS-Ala148,Ala271
Plasmid#158633PurposeGateway entry vector for an inducible 3xFLAG-tagged MAVS mutantDepositorAvailable SinceSept. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLIK 3xFLAG-MAVS-Ala148,Ala271 hygro
Plasmid#158639PurposeLentiviral expression vector for an inducible 3xFLAG-tagged MAVS mutant constructDepositorAvailable SinceSept. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLIK 3xFLAG-MAVS-Ala148 hygro
Plasmid#158636PurposeLentiviral expression vector for an inducible 3xFLAG-tagged MAVS mutant constructDepositorAvailable SinceSept. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLIK 3xFLAG-MAVS-Gln93 hygro
Plasmid#158635PurposeLentiviral expression vector for an inducible 3xFLAG-tagged MAVS mutant constructDepositorAvailable SinceSept. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJEP319-pAAV-U6SaCas9gRNA(emx1sg2)-EFS-GFP-KASH-pA
Plasmid#113696PurposeU6 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1, followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP318-pAAV-U6SaCas9gRNA(emx1sg1)-EFS-GFP-KASH-pA
Plasmid#113695PurposeU6 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1, followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pscALPSpuro-MmACE2 (Mouse)
Plasmid#158087PurposeExpresses mouse ACE2 in mammalian cellsDepositorAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJEP314-pAAV-U6SaCas9gRNA(SapI)-CMV-SaCas9-DIO-pA
Plasmid#113691PurposeU6 driven SaCas9 gRNA expression cassette followed by a CMV driven inverted SaCas9. SaCas9 is floxed to render the system cre-dependent.DepositorInsertSaCas9
UseAAV, CRISPR, and Cre/LoxTagsNLSPromoterCytomegalo Virus(CMV)Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGS_101
Plasmid#160541PurposeExpresses Human APOE4 with a yeast secretory signal peptide under the control of the yeast Gal promoterDepositorInsertApolipoprotein E e4 (APOE Human)
TagsKar2 signal sequenceExpressionYeastMutatione4 allelePromoterGAL1Available SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC19-OCT4-T2A-NLS-EmGFP-P2A-Puro
Plasmid#89992PurposeDonor template for generation of OCT4-T2A-nEmGFP reporter cell linesDepositorAvailable SinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pscALPSpuro-MjACE2 (Pangolin)
Plasmid#158084PurposeExpresses pangolin ACE2 in mammalian cellsDepositorAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGS_128
Plasmid#160651PurposeExpresses Human APOE3 with a yeast secretory signal peptide under the control of a beta-estradiol inducible promoterDepositorInsertApolipoprotein E e3 (APOE Human)
TagsKar2 signal sequenceExpressionYeastMutatione3 allelePromoterpZ estradiol inducible promoterAvailable SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEF5/FRT/DEST-3xHA/mGli3/Flag P1-6A
Plasmid#51248PurposeEncodes N-3xHA-TEV-mouseGli3-Flag-C; amino acids 849,865,877,907,980,1006 mutated to AlaDepositorInsertGli3 (Gli3 Mouse)
UseFlpin systemTags3xHA-TEV and FlagExpressionMammalianMutationamino acids 849,865,877,907,980,1006 mutated to A…PromoterEF1aAvailable SinceMarch 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pscALPSpuro-HsACE2 (human)
Plasmid#158081PurposeExpresses human ACE2 in mammalian cellsDepositorAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
PB-mCherry-DMDEx23-eGFP
Plasmid#211366PurposePiggybac transposon plasmid for a DMD exon 23 skipping reporter (mCherry-DMDEx23)DepositorInsertmCherry-DMDEx23-eGFP
ExpressionMammalianMutationmCherry interrupted by mdx dystrophin exon 23 bet…PromoterCAGAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGS_107
Plasmid#160650PurposeExpresses Human APOE4 with a yeast secretory signal peptide under the control of the yeast Gal promoterDepositorInsertApolipoprotein E e4 (APOE Human)
TagsKar2 signal sequenceExpressionYeastMutatione4 allelePromoterGAL1Available SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGS_129
Plasmid#160652PurposeExpresses Human APOE4 with a yeast secretory signal peptide under the control of a beta-estradiol inducible promoterDepositorInsertApolipoprotein E e4 (APOE Human)
TagsKar2 signal sequenceExpressionYeastMutatione4 allelePromoterpZ estradiol inducible promoterAvailable SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EMTB-TurboID-V5-puro
Plasmid#190741PurposeA lentiviral plasmid encoding EMTB fusion to V5-tagged TurboID on microtubules (EMTB as the microtubule-targeting tag)DepositorInsertEMTB-TurboID-V5 (RPS14 EMTB is human ensconsin; TurboID is engineered BirA from E.coli, Human)
UseLentiviralTagsMycExpressionMammalianMutationMicrotubule binding-domain of ensconsin (amino ac…PromoterCMVAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only