We narrowed to 3,399 results for: FRI;
-
Plasmid#68821PurposeEGFP tagged Collybistin expression in mammalian cellsDepositorAvailable SinceAug. 27, 2015AvailabilityAcademic Institutions and Nonprofits only
-
pcDNA 3.3 ss-V5-hFZD4 (aa 37-537)
Plasmid#115787PurposeExpresses human FZD4 with N-terminal V5-tag in mammalian cells, contains artificial signal sequence upstream of tag.DepositorAvailable SinceOct. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-NDUFS6-mVenus
Plasmid#185806PurposeNDUFS6 Complex I sub-unit with C-terminus mVenus tagDepositorAvailable SinceOct. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Flag-NSF/T645A
Plasmid#74936PurposeMammalian expression of human NSF mutant T645A (mutation in the D2 domain of the protein)DepositorInsertNSF (NSF Human)
TagsFLAGExpressionMammalianMutationT645A (mutation in the D2 domain of the protein)PromoterCMVAvailable SinceApril 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9-2A-GFP-sgRNA-DNA-PKcs
Plasmid#220493PurposeTo generate DNA-PKcs KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against DNA-PKcs exon 1.DepositorAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBABE-hygro-2xMyc-Rac1-WT
Plasmid#128580PurposeFor mammalian cell expression of WT murine RAC1 carrying 2x Myc epitope tag sequences at the N-terminus.DepositorAvailable SinceAug. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
GFP-ataxin-3 *VBM
Plasmid#89976PurposeExpresses GFP-tagged ataxin-3 with a mutation in the VCP-binding motifDepositorAvailable SinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
GFP-ataxin-3 C14A
Plasmid#89977PurposeExpresses catalytic inactive GFP-tagged ataxin-3DepositorAvailable SinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
GFP-Trim46
Plasmid#176402PurposeTRIM46 tagged with GFPDepositorAvailable SinceOct. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
GPX8 rescue PLAK1
Plasmid#161517PurposeRescues the expression of GPX8 in GPX8 plenti-CRISPR KO cellsDepositorAvailable SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
EGFPC2-CB2 SH3-
Plasmid#68822PurposeEGFP tagged Collybistin expression in mammalian cellsDepositorAvailable SinceAug. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
mCherry-Trim46
Plasmid#176401PurposeTRIM46 tagged with mCherryDepositorAvailable SinceOct. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-flex-Voltron-ST
Plasmid#119036PurposeCre-dependant expression of soma-localized Voltron in neuronsDepositorHas ServiceAAV1InsertVoltron-ST
UseAAV and Cre/LoxExpressionMammalianPromoterhsynAvailable SinceDec. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-hARΔ142–337
Plasmid#89106PurposeMammalian expression of human androgen receptor with deletion of amino acids 142-337 N-terminal transactivation function 1DepositorAvailable SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1_MeCP2(deltaNIC)
Plasmid#110191PurposeExpression of mouse MeCP2 (deltaNIC) in mammalian cellsDepositorInsertMeCP2_e2 delta NIC (mouse cDNA) - EGFP (Mecp2 Mouse)
TagsEGFPExpressionMammalianMutationdelta N and C termini. Intervening region replace…PromoterCMVAvailable SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYUU
Plasmid#159751PurposeUbiquitin promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter). Selection of transgenic seeds by YFP fluoresce.DepositorArticleInsertgRNA scaffold
UseCRISPRExpressionPlantAvailable SinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGEM-2t
Plasmid#159752PurposeCRISPR/Cas9 genome editing in plants; a template for PCR-derived fragments used in the assembly of polycistronic transcripts, where sgRNAs are separated by an Arabidopsis alanine tRNA.DepositorArticleInsertsgRNA
UseCRISPRAvailable SinceOct. 6, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pYEE
Plasmid#159750PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter). Selection of transgenic seeds by YFP fluoresce.DepositorArticleInsertgRNA scaffold
UseCRISPRExpressionPlantAvailable SinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pENTR221 UBR5 ∆PABC
Plasmid#81064PurposeGateway entry vector encoding full length UBR5 Y2402A/K2415A (∆PABC)DepositorInsertUbiquitin protein ligase E3 component N-recognin 5 (UBR5) ∆PABC (UBR5 Human)
UseCloningMutationY2402A and K2415A (bp t7204g, a7205c, t7206c, a72…PromoterN/AAvailable SinceJan. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
HA-GFP1-10-actin-pcDNA4-TO
Plasmid#118370PurposeBimolecular Fluorescence Complimentation (BiFC) assay. Mammalian expression vector to generate stable, inducible cell line expressing N-terminally tagged HA-GFP1-10-actin.DepositorAvailable SinceMay 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTEE
Plasmid#159748PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter). Selection of transgenic seeds by mTomato fluoresce.DepositorArticleInsertgRNA scaffold
UseCRISPRExpressionPlantAvailable SinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-NDUFV2-mVenus
Plasmid#185653PurposeNDUFV2 Complex I sub-unit with C-terminus mVenus tagDepositorAvailable SinceAug. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCR3-FLAG-Gephyrin GC
Plasmid#68818PurposeFlag tagged mammalian expression of GC domainDepositorAvailable SinceAug. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTUU
Plasmid#159749PurposeUbiquitin promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter). Selection of transgenic seeds by mTomato fluoresce.DepositorArticleInsertgRNA scaffold
UseCRISPRExpressionPlantAvailable SinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
His-GST-Cys-M87 Spastin
Plasmid#184804PurposeBacterial expression of M87 Spastin (A2C mutation)DepositorAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHAGE N' EGFP NAP1 FL IRES Blast
Plasmid#179100PurposeExpression of full length NAP1 cDNADepositorInsertNak associated protein 1 (AZI2 Human)
UseLentiviralTagsEGFPExpressionMammalianPromoterCMVAvailable SinceOct. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-NDUFA7-mVenus
Plasmid#185647PurposeNDUFA7 Complex I sub-unit with C-terminus mVenus tagDepositorAvailable SinceOct. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
HNF4A_P2-257
Plasmid#31063DepositorInsertHNF4A P2 promoter (HNF4A Human)
UseLuciferaseExpressionMammalianMutation-257 to -1 of P2 HNF4A promoterAvailable SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
HNF4A_P2-164
Plasmid#31066DepositorInsertHNF4A P2 promoter (HNF4A Human)
UseLuciferaseExpressionMammalianMutation-164 to -1 of P2 HNF4A promoterAvailable SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only