We narrowed to 3,021 results for: COB
-
Plasmid#205883PurposeExpress mEGFP-tagged fusion protein, PAX5_JAK2 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pGL4.23-GW
Plasmid#60323PurposeThis is a modified version of the pGL4.23 vector from Promega, containing a Gateway cassette upstream of the minimal promoter. This vector can be used for for Gateway cloning of candidate enhancer elements. As negative control, use pGL4.23 without the gateway cassette (available from Promega).DepositorTypeEmpty backboneUseLuciferaseTagsLuciferaseExpressionMammalianAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV uN2C GFP (Ctl)
Plasmid#224355PurposeExpress GFP tagged upsteram ORF of NOTCH2NLC with a control size (12x) of GGC repeatsDepositorInsertuN2C
UseAAVTagseGFPExpressionMammalianMutationCodon-optimized for expression in human, so no pu…PromoterCMV + chimeric intyron (CAG)Available SinceOct. 7, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
CL20_mEGFP_PML_RARA
Plasmid#205897PurposeExpress mEGFP-tagged fusion protein, PML_RARA from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
dCas9-p300 PHD-HAT
Plasmid#179545Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 PHD-HAT domain (aa 1243-1664) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human p300 PHD-HAT domain (aa 1243-1664) (EP300 Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hDlx-GqDREADD-dTomato-Fishell-4
Plasmid#83897PurposeGq-DREADD (P2A) nuclear dTomato expression in forebrain GABA-ergic interneurons under the control of the hDlx enhancer elementDepositorHas ServiceAAV Retrograde, AAV1, and AAV9InserthM3Dq
UseAAVExpressionMammalianPromoterhDlxAvailable SinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUC19_HDRT_TRAC_CD19-CAR
Plasmid#183473PurposeEncodes for a homology-directed DNA repair template for the insertion of a second generation CD19-specific CAR into the TRAC geneDepositorAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_NPM1_ALK
Plasmid#205868PurposeExpress mEGFP-tagged fusion protein, NPM1_ALK from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_KIAA1549_BRAF
Plasmid#205838PurposeExpress mEGFP-tagged fusion protein, KIAA1549_BRAF from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_KMT2A_MLLT1
Plasmid#205842PurposeExpress mEGFP-tagged fusion protein, KMT2A_MLLT1 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_CBFA2T3_GLIS2
Plasmid#205786PurposeExpress mEGFP-tagged fusion protein, CBFA2T3_GLIS2 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hDlx-GiDREADD-dTomato-Fishell-5
Plasmid#83896PurposeGi-DREADD (P2A) nuclear dTomato expression in forebrain GABA-ergic interneurons under the control of the hDlx enhancer elementDepositorHas ServiceAAV Retrograde, AAV1, and AAV9InserthM4Di
UseAAVExpressionMammalianPromoterhDlxAvailable SinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_TAF15_ZNF384
Plasmid#205932PurposeExpress mEGFP-tagged fusion protein, TAF15_ZNF384 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_ETV6_NTRK3
Plasmid#205817PurposeExpress mEGFP-tagged fusion protein, ETV6_NTRK3 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKSR1-CA3-EGFP (C-KSR)
Plasmid#217753PurposeFluorescent reporter for ceramide (mammalian expression)DepositorInsertKinase suppressor of ras 1 CA3 domain (KSR1 Human)
TagsEGFPExpressionMammalianMutationCA3 domain aa 317-400 plus vector-based linker LE…PromoterCMVAvailable SinceJune 10, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
CL20_mEGFP_TCF3_HLF
Plasmid#205935PurposeExpress mEGFP-tagged fusion protein, TCF3_HLF from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR207 SARS-CoV-2 NSP3
Plasmid#141257PurposeGateway-compatible Entry vector, with insert of NSP3 gene's CDS from SARS-CoV-2 isolate Wuhan-Hu-1DepositorHas ServiceCloning Grade DNAInsertNSP3 (ORF1ab SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway CloningMutationMany synonymous changes due to codon optimizationAvailable SinceApril 1, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
CL20_mEGFP_KMT2A_MLLT10
Plasmid#205843PurposeExpress mEGFP-tagged fusion protein, KMT2A_MLLT10 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CBP core
Plasmid#179543Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human CBP core (aa 1084-1701) driven by EF-1alpha promoterDepositorInsertS. Pyogenes dCas9 with c-terminal human CBP core (aa 1084-1701) (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only