We narrowed to 911 results for: Tro;

...of each well at 450 nm on the spectrophotometer. Use the spectrophotometer to generate a standard curve...Antibody Purification Protocol Antibody Guide Introduction This protocol describes how to run an indirect...antibody incubation and plate read Tips and Troubleshooting The optimal concentration of primary antibody...an automated ELISA plate washer. Equipment Spectrophotometer compatible with 96-well plates 1–10 µL single...Multichannel pipette reagent reservoirs Pipette controller Microcentrifuge Microplate shaker ELISA plate... antigen Purified recombinant antibody Isotype control antibody HRP-conjugated isotype-specific secondary...mix. Dilute the primary antibody and an isotype control antibody to the desired concentrations in the antibody...

...questions. Intro to the Lab Bench Basic Molecular Biology Plasmid Cloning Virus Antibodies Intro to the Lab... Lab Bench Introductory techniques designed to help you get started in the lab. Name Description (Link...Quantification Measure DNA concentration with a spectrophotometer Restriction Digests Cut and analyze plasmid...plasmid DNA with restriction enzymes Agarose Gel Electrophoresis Separate DNA by size on an agarose gel Watch...DNA using DNA ligase Bacterial Transformation Introduce DNA into a bacterial strain Watch the Video! CRISPR...Description Link to Video General Transfection Introduce plasmid DNA to mammalian cells Lentivirus Production.... Name Description Link to Video Transfection Introduce plasmid DNA to mammalian cells to produce antibodies...

...DNA Ligation Introduction Transformation is the process by which foreign DNA is introduced into a cell....should also add a positive control (many companies include a positive control plasmid with their competent...ligation of inserts to vectors than for an intact control plasmid. Incubate the competent cell/DNA mixture...transform large plasmids, it is a good idea to use electro-competent cells. Instead of relying on the heat-shock...heat-shock to cause the cells to take up the DNA, an electro-magnetic field is applied to the cell/DNA mixture... do this you will need to have access to an electroporator and the appropriate cuvettes. Follow the manufacturer's...

...and FAQ Do controls When doing ligations you should ALWAYS do a vector alone + ligase control. This will...ligation. Additional controls are encouraged, but may only be required for troubleshooting failed ligations...The following table indicates the various controls: Control Ligase Interpretation Uncut vector - Checks...know has only been thawed once before. Always do controls. See Tips and FAQ below for details. Try different...treated, that the phosphatase treatment worked. This control should, in principle, be free of colonies, but ...

...purity. This can be done with a spectrophotometer. A spectrophotometer uses the absorbance/transmission... instructions for the spectrophotometer specific to your lab. Spectrophotometer Tips Before measuring ...labs have a NanoDrop, which is a very small spectrophotometer that can accurately read DNA concentration...measuring any samples, be sure to ‘blank’ the spectrophotometer using the solution the DNA is resuspended in, ...NanoDrop. It is a good idea to re-zero any spectrophotometer between samples if they are expected to vary...

...an uncut sample of each vector to help with troubleshooting if your digests don’t look as you expected....product is the anticipated size and that your band is strong (indicating that the PCR reaction worked and that...insert. It is also important to set up negative controls in parallel. For instance, a ligation of the recipient...much less total DNA (<1ng) or if you are having trouble getting colonies, you might want to use higher ...to be very large (>10kb) you might want to use electro-competent cells instead of the more common chemically-competent...plasmid alone plate. The recipient plasmid alone control will tell you your “background” level or more specifically...see any colonies, you should conduct a positive control to ensure that your transformation worked. You ...

...Restriction Digest of Plasmid DNA Agarose Gel Electrophoresis Introduction Restriction enzymes are naturally occurring...and analyze the resulting fragments by gel electrophoresis . The pattern of the fragments on the gel can...to analyze a restriction digest. Equipment Electrophoresis chamber Pipetman Pipet tips Reagents Liquid...manufacturer's instructions) Gel loading dye Electrophoresis buffer Verifying Total Plasmid Size -OR- Insert...avoided. If you do have to do so, there is no way to control which orientation the insert is ligated into the... tricks see the Restriction Digest and Gel Electrophoresis pages....

... uncut sample of each plasmid to help with troubleshooting if your digests don’t look as you expected....insert. It is also important to set up negative controls in parallel. For instance, a ligation of the recipient...much less total DNA (<1ng) or if you are having trouble getting colonies, you might want to use higher ...to be very large (>10kb) you might want to use electro-competent cells instead of the more common chemically-competent...plasmid alone plate. The recipient plasmid alone control will tell you your “background” level or more specifically...see any colonies, you should conduct a positive control to ensure that your transformation worked. You ...depending on the number of background colonies on your control plate (the more background, the more colonies you...

...channel pipette Pipette controller Pipette tips and pipettes Spectrophotometer Heat block Mini gel tank...Protocol Recombinant Antibody Purification Protocol Introduction Western blot is a technique used to separate...ladder. Place the lid on the tank and plug the electrode cords into the power supply. Run the gel at 100... a dark room to detect the bands. Tips and Troubleshooting The optimal lysis buffer will vary depending...as expected and is specific, include a positive control sample that you know expresses the protein, such...transfected with the protein of interest, and a negative control sample that does not express the protein of interest...

...Viral Service Lentivirus Guide Virus Blog Posts Introduction This protocol describes how to use droplet digital...ribonuclease P/MRP 30 kDa subunit (RPP30) are used as a control for normalization. The dilution series outlined...wells containing the virus and the untransduced control. Pro-Tip For even seeding, prepare a batch for ...Determine the concentration of each sample on a spectrophotometer. Prepare 25 ng/µL stocks of each sample. Samples...calculate the final infectious titer. Tips and Troubleshooting We recommend wiping down all pipettes and equipment...concentration of RRE positive droplets in the untransduced control should be close to zero (A01). In this protocol...

...Protocol Recombinant Antibody Purification Protocol Introduction Immunocytochemistry is a technique that uses...Day 3-4: Fix and label cells Equipment Pipette controller Pipette tips and pipettes Rocking platform Tweezers... appropriate fluorescent filters. Tips and Troubleshooting The optimal fixation method will vary depending...functioning as expected and specific, include a positive control sample that you know expresses the protein, such...express the protein of interest, and a negative control sample such as cells that do not express the protein...

...Virus Blog Posts Mol Bio Protocols Viral Service Introduction This protocol can be used to titer lentivirus...titer of your lentiviral preparation allows you to control the multiplicity of infection (MOI) in downstream...channel pipette Ice bucket CO 2 incubator Pipet controller Hazardous waste container Reagents DMEM high ...All of the cells in the untransduced (negative) control well should be killed and no colonies should be...appropriate antibiotic. When the untransduced (negative control) cells have died and colonies are visible in the...

...Gel Purification Molecular Biology Reference Introduction This protocol describes how to extract RNA from...unlike using a p1000 tip it will give you more control of where you’re aiming your tip in the tube. Precipitate...the quality of your RNA sample(s) using a spectrophotometer (such as a Nanodrop), agarose gel, or bioanalyzer...

...gel electrophoresis, which separates DNA by their length in base pairs. Following electrophoresis, you...Restriction Digest of Plasmid DNA Agarose Gel Electrophoresis DNA Ligation Background Information Gel purification...Protocol: Gel Purification Follow the Agarose Gel Electrophoresis Protocol with the following amendments: Notes...

... Technology Protocol Agarose Gel Electrophoresis Gel electrophoresis is the standard laboratory procedure...visualization and purification. Agarose Gel Electrophoresis Protocol Purifying DNA from an Agarose Gel ...DNA fragments based on size. Following gel electrophoresis, you can cut DNA bands out of the agarose gel...

...Virus Blog Posts Mol Bio Protocols Viral Service Introduction This protocol can be used to titer lentiviral... titer of your lentiviral vector allows you to control the multiplicity of infection (MOI) in downstream...channel pipette Ice bucket CO 2 incubator Pipet controller Hazardous waste container Inverted fluorescence...dilution with one well remaining as the untransduced control). Count the cells in the remaining well, a cell...

...Purifying DNA from an Agarose Gel DNA Ligation Introduction Restriction enzyme digestion takes advantage...your restriction digest results. Equipment Electrophoresis chamber Pipetman Reagents Liquid DNA aliquot...manufacturer's instructions) Gel loading dye Electrophoresis buffer Pipet tips Procedure Select restriction...visualize the results of your digest, conduct gel electrophoresis . Tips and FAQ Restriction enzymes MUST be ...

...Using a Light Microscope Using a Light Microscope Intro to the Lab Bench Check out more protocols and videos...videos to help you get started in the lab! Introduction Microscopes are emblematic of biological research... cheap and accessible) to massive transmission electron microscopes that allow us to see cellular components...resolution when your image is in focus, which you can control using the focus knobs on the side of the microscope...

...Virus Blog Posts Mol Bio Protocols Viral Service Introduction This protocol can be used to generate stable...channel pipette Ice bucket CO 2 incubator Pipet controller Hazardous waste container Reagents DMEM high ...plate will hold 5 dilutions plus one 'no virus' control well). Perform a "reverse transduction" by seeding...selection should last at least as long as it takes the control (untransduced) cells to completely die. After that...

...express Cas9 and are included as a control (WT). Vinculin is a loading control. 1 lentiCas9-Blast was a gift...Virus Blog Posts Addgene Protocols Viral Service Introduction This protocol describes how to generate a monoclonal...µL single channel pipette CO 2 incubator Pipet controller Hazardous waste container Microscope Hemocytometer...

...Design a Primer Diagnostic Restriction Digest Introduction Sequence verification of important plasmid features... do not sequence the entire plasmid. Addgene strongly recommends that you sequence any portion of the...What primers were used by Addgene during quality control? Addgene lists the primers used to obtain each ...

...cloning scars"). A “stuffer” sequence allows for electrophoretic separation of linearized vector from the reaction...linearized vector from the reaction mixture by gel electrophoresis followed by gel purification . The cut vector... your chances of success. Set up a vector only control with water instead of the insert. Incubate the ...

...Protocols Centrifugation Centrifugation Protocol Intro to the Lab Bench Check out more protocols and videos...videos to help you get started in the lab! Introduction A centrifuge is a common piece of laboratory equipment...the rotor with microfuge tubes in place, and the control panel where you can set the time and speed needed...

...and 30 bp annealing to the target sequence. Avoid strong secondary structures in the homology region. Hairpins...seams between the assembled parts. Tips and Troubleshooting “Stitching” fragments together using oligos...oligos. This technique is especially useful for introducing promoters, terminators, and other short sequences...

... Biosafety Levels One and Two (BSL-1 and BSL-2) Intro to the Lab Bench Check out more protocols and videos...videos to help you get started in the lab! Introduction There are four biosafety levels. This protocol...protocols require bloodborne pathogens training. It is strongly recommended that anyone participating in BSL-2...

...like... Viral Vector Guides Mol Bio Protocols Introduction This protocol can be used to produce lentivirus...channel pipette Ice bucket CO 2 incubator Pipet controller Hazardous waste container pH meter Stir plate... should be aliquoted and snap frozen in liquid nitrogen and stored at -80 °C as soon as possible to avoid...

...like... Bacterial Transformation Agarose Gel Electrophoresis Agarose Gel DNA Purification Streaking and ...Bacteria Inoculating a Liquid Bacterial Culture Introduction Many molecular biology techniques require highly...window) Qiagen , (Link opens in a new window) Invitrogen , and (Link opens in a new window) Promega sell...

...standard Polymerase Chain Reaction (PCR) is an in vitro method that allows a single, short region of a DNA...product can be verified based on size by gel electrophoresis . Protocol Video Watch the protocol video below...to each reaction. The ideal setup for this troubleshooting step is to do one reaction with each, and one...

...Vector Guides Virus Blog Posts Mol Bio Protocols Introduction The AAV Titration protocol can be used to determine...samples being tested. Always include a No Template Control (NTC), i.e master mix + water Whenever possible...duplicate. Do not forget to include a no template control ( NTC = master mix + water ). Add 15 μL of Master...

... Versus Gamma-Retrovirus Lentiviruses and gamma-retroviruses fall under the Retroviridae family. The genome...Glossary Lentiviruses are a type of retrovirus and belong to the Retroviridae family. Infection with lentiviruses...variety of cell types than retroviruses. Both lentiviruses and gamma-retroviruses use the same packaging ...packaged by gamma-retroviral packaging systems, and vice versa. For more about gamma-retroviruses, see Addgene's...Panch, S. R., Jin, P., & Stroncek, D. F. (2022). Genome-wide profiling of retroviral DNA integration and its..., leading to disease. Lentivirus A retrovirus from the Retroviridae family. Characterized by long incubation...BIV), and feline immunodeficiency virus (FIV). Retroviruses are partially characterized by their ability...

...studied, and has a broad tissue tropism. Table 1 gives a summary of the tropism of AAV serotypes, indicating...variant able to display neuronal retrograde transport, AAVrg. Retrograde transport refers to the direction...disease, spinal muscular atrophy, hemophilia A and B, and Duchenne muscular dystrophy. Many clinical trials...injection. Different AAV serotypes exhibit strong neuronal tropism, meaning they can efficiently target specific...therefore non-pathogenic and generally do not trigger a strong immune response. These features have made AAVs ...are transfected into cells which then act as in vitro factories for the new viral particles in the laboratory...serotypes are AAV variants that differ in their tropism — that is, the types of cells they infect. Serotypes...

...negative control. The negative control may be a no-antibody control in which a sample is processed without ...standard curve can serve as the positive control); and a negative control, a sample known not to contain your...interest. The negative control should be biological (no protein expressed), which controls for your antibody...fragmentation of the DNA. Controls for capture methods Capture methods should use a positive control and a negative...addition to the control used in standard IP, ChIP should additionally use a beads-only control which runs ...the machine. Controls for cell sorting methods Flow cytometry requires a negative control, a small subset...animal’s immune system. The antigen of interest is introduced to the animal, which then mounts an immune response...

...(genetically-encoded tools for light-activated control of proteins) and sensors (genetically-encoded reporters... common optogenetic actuators used for optical control of proteins and cells, including microbial opsins...These various opsins also initiate different electrochemical responses, such as nonspecific cation influx...subsets of neurons, allowing precise spatiotemporal control of these neurons by turning on and off the light...Wild-type halorhodopsin, known as NpHR (from Natronomonas pharaoni ), causes hyperpolarization (inhibition.../NpHR Light-driven inward chloride pump from Natronomonas pharaonis , used to silence neuronal activity...illuminated. There are several different ways to control opsin expression. Generally, the most robust and...

...Constitutive Insect Strong promoter from baculovirus CAG Constitutive Mammalian Strong hybrid promoter; ...Constitutive Mammalian Strong promoter from human cytomegalovirus EF1a Constituitve Mammalian Strong promoter from...vital component of expression vectors because they control the binding of the RNA polymerase to DNA. RNA polymerase... functional protein. Thus, the promoter region controls when and where in the organism your gene of interest... are proteins which recruit RNA polymerase and control and regulate the transcription of DNA into mRNA... bind to a promoter. Transcription is tightly controlled in both bacteria and eukaryotes by various DNA...consists of the sequence TTGACA, and this element controls the rate of transcription. Bacterial cells contain...

...strength of the promoter can control the level of insert expression, as a strong promoter directs high expression...BL21 Invitrogen; New England BioLabs E. coli B F dcm ompT hsdS(rB mB) gal ccdB Survival Invitrogen F- mcrA...molecular pathways and diseases. Here we present an introduction to plasmids and a collection of other molecular...genes as carriers of phenotypic information was introduced in the early 19th century by Gregor Mendel, who... restriction enzymes, DNA ligases, and gel electrophoresis enabled the movement of specific fragments ...of another antibiotic resistance gene under the control of a non-bacterial promoter or a fluorescent protein...create viral particles (most commonly lentiviral, retroviral, AAV, or adenoviral particles) that can infect...

...Addgene's Blog An Introduction to Adenovirus Adenoviral Vector Production and Troubleshooting Adenoviral Delivery...recognizes adenoviral elements rapidly and can mount a strong immune response quickly, which has limited their...double-stranded circular episomes. Due to this, and to the strong host’s immune response against the transduced cells...G). Different serotypes exhibit varying tissue tropisms, meaning they preferentially infect certain tissues...proteins. Researchers have further refined the tropism of rAdV vectors by mixing capsids and genomes from...vector features such as transduction efficiency, tropism and immunogenicity. For example, Ad5/35 and Ad5...viral vector uptake and transgene expression. This strong immune response has become a disadvantage for the...

...provide a basic understanding of CRISPR biology, introduce the various applications of CRISPR, and help you...research. CRISPR Basics In this section, we will introduce the basic mechanisms of CRISPR and some of the... nuclease fidelity SpCas9-NG — NG; increased in vitro activity SpG — NGN; increased nuclease activity ...-occurring Acr (Anti-CRISPR) proteins can help control CRISPR activity. Acr proteins have evolved in phages...LmoCas9 and SpCas9. Acr proteins can be used to control both when and where genome editing happens. CASANOVA...Dominik Niopek’s lab , is a way to optogenetically control genome editing by fusing the anti-CRISPR protein...photosensitive LOV2 domain . Several labs have also controlled Acr activity with endogenous cell-type specific...

... However, neuronal control through PSAMs and LMOs is direct, while neuronal control of DREADDs is indirect...endogenous signaling, therefore allowing precise control over the cell population they are targeted to. ...used in the same organism to allow bidirectional control of neuronal activity. Table 1: Descriptions of ...chemogenetic receptors that confer more direct control of neurons through manipulation of ion channels...expression of AAV-delivered constructs can be controlled with cell-type specific promoters. Table 4 lists...unwanted cell types. Generating a FLEx switch to control expression of a chemogenetic reporter ensures that...N. C. (2024). Efficient opto- and chemogenetic control in a single molecule driven by FRET-modified bioluminescence...

...Protective Equipment (PPE) for BSL-1 and BSL-2 Labs Intro to the Lab Bench Check out more protocols and videos...videos to help you get started in the lab! Introduction There are four biosafety levels. This protocol...

...CRISPR Experiment Jump To: Plan Your Experiment Introduction Select Genetic Manipulation Design and Clone...generally perform by chemical transfection or electroporation. Expression can be transient, or you can generate... of Cas and gRNA. This method involves using in vitro transcription reactions to generate mature Cas mRNA... to target cells through microinjection or electroporation. The target cells translate the mRNA encoding...you directly combine purified Cas protein and in vitro transcribed gRNA to form a Cas-gRNA complex. You...delivery the RNP to cells using cationic lipids, electroporation, or an endosomal approach. Similar to the mRNA...Weissman, J. S. (2014). Genome-Scale CRISPR-Mediated control of gene repression and activation. Cell , 159 (...

...Pooled Libraries Jump To: Pooled Library Guide Introduction Library Amplification Types of Screens Resources...postivie or negative screens. The use of appropriate controls (positive and negative) is the responsibility ...the same basic process: Amplify the library (electroporation and maxiprep). If delivering as virus, make... Perform Next Generation Sequencing (NGS) on a control sample (no selection) In parallel, apply library...cells Compare NGS results between experimental and control cells Generate a list of gRNAs that disappear with... post-selection. The selective pressure must be strong enough that most of the cells die, removing their...selection while the other serves as a non-selected control. These two populations are then sequenced using...

...Reverse Bglob-intron-F CTGGTCATCATCCTGCCTTT Rabbit beta-globin intron Forward Bglob-intron-R TTTGCCCCCTCCATATAACA...for inserts in pBMN retroviral vector MMLV sequence, for inserts in pBMN retroviral vector Forward pBR322ori-F...TTTGCCCCCTCCATATAACA Rabbit beta-globin intron Reverse Bglob-pA-R TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin polyA... pCAG-F GCAACGTGCTGGTTATTGTG Rabbit beta-globin intron, for pCAG plasmids Forward pCasper-F GGGTTTTATTAACTTACAT...pMT2-F TTGCCTTTCTCTCCACAGGT 3' end of synthetic intron Forward pMX-S1811 GACGGCATCGCAGCTTGGATACAC MMLV...

...Recovering Plasmid DNA from Bacterial Culture Introduction If you have a glycerol stock or stab culture...would hold a pencil, so that you can make a broad stroke. Only touch the surface of the plate, do NOT dig...

...Recovering Plasmid DNA from Bacterial Culture Introduction This protocol describes methodology for plating...concentrations of carbenicillin plated over-agar. Control Plate with No Carbenicillin Plate shows a lawn ...

...Protocols Weighing Reagents Weighing Reagents Protocol Intro to the Lab Bench Check out more protocols and videos...videos to help you get started in the lab! Introduction For many experiments, you’ll need to make buffers...

... Protocols Water Bath Water Bath Protocol Intro to the Lab Bench Check out more protocols and videos...videos to help you get started in the lab! Introduction A water bath is a piece of laboratory equipment...

.... MoClo Plant Parts Kit Plant Expression Nicola Patron 95 standardized parts specific for plant synthetic...Toolkit Yeast Expression Volker Sieber Plasmids with control elements and fluorescent reporters to be used in...Toolkit Bacterial Expression, Fungal Expression Nili Ostrov , Charlie Gilbert , and Cultivarium Tools 189 plasmids...MoClo-compatible CRISPR/Cas9 cloning kit with intronized Cas9 Genome Engineering, CRISPR Sylvestre Marillonnet...constructs are made with zCas9i, a high efficiency intron-optimized SpCas9-coding gene. MoClo CRISPR/Cas ...Resources Guide to DNA Assembly Techniques by Nicola Patron at The Sainsbury Laboratory Weber E, Engler C, ... M, Gruetzner R, Ehnert TM, Werner S, Jones JD, Patron NJ, Marillonnet S. A golden gate modular cloning...

...Virus Blog Posts Mol Bio Protocols Viral Service Introduction This protocol describes a general method for...channel pipette Ice bucket CO 2 incubator Pipet controller Hazardous waste container Reagents DMEM high ...

... Protocols Pipetting Pipetting Protocol Intro to the Lab Bench Check out more protocols and videos...videos to help you get started in the lab! Introduction The pipette is an essential tool for nearly anyone...

...Vector Guides Virus Blog Posts Mol Bio Protocols Introduction This protocol can be used to purify AAV of any...VP2, VP3; M protein marker. Image adapted from Strobel Benjamin, Miller Felix D., Rist Wolfgang, and Lamla...