Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 916 results for: Tro;

Showing: 851 - 900 of 916 results

  1. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...Read our gamma-retroviral guide to learn about gamma-retroviral components, retroviral production, and...Guides Gamma-Retroviral Vector Guide Gamma-Retroviral Vector Guide Jump To: Gamma-Retroviral Vectors Vector...Glossary Gamma-retroviruses are a subtype of retrovirus and belong to the Retroviridae family. Gamma-retrovirus...Lentiviruses and gamma-retroviruses fall under the Retroviridae family. The genome of retroviruses is made of RNA...known as tropism). Figure 2: Gamma-retroviral plasmids. Created with BioRender.com. Gamma-Retroviral Vector...Definition Gamma-retrovirus A retrovirus from the Retroviridae family. Characterized by long incubation...decades. Wildtype gamma-retroviruses have been engineered into gamma-retroviral vectors that can be safely...

  2. CRISPR Library Amplification

    Type
    Protocol
    ... mix. Electroporate cells (one at a time for a total of eight electroporations): Electroporator Conditions...centrifuge BioRad Electroporator (MicroPulser TM , Bio-Rad 1652100) Reagents 200 µL electrocompetent cells (Default... 10 cfu/µg) commercially prepared electrocompetent cells is strongly recommended. 800 ng pooled library...and have 1 mL SOC per electroporation readily available for post-electroporation recovery of cells. Ensure... How do I process my Addgene pooled library? Introduction Please refer to our pooled library material ...according to the actual number. Required Quality Control (QC) Pooled libraries can be challenging and expensive...Stbl4 cells or other ultra-high efficiency electrocompetent cells that are suitable for unstable or recombination-prone...

  3. Coomassie Purity Stain of Recombinant Antibodies

    Type
    Protocol
    ...single channel pipette Pipette controller Microcentrifuge Electrophoresis chamber Power supply Rocking ... 1mm thick, 10-well, Invitrogen NP0321BOX 20X MOPS SDS running buffer, Invitrogen NP0001 4X NuPage sample...buffer, Invitrogen NP0007 10X NuPage sample reducing agent (500 mM dithiothreitol, DTT), Invitrogen NP0009...Antibodies Recombinant Antibody Purification Protocol Introduction This protocol describes how to determine the...separated by denaturing polyacrylamide gel electrophoresis alongside serial dilutions of a standard antibody...NP0009 PageRuler Plus Prestained protein ladder, Invitrogen 26619 Pipette tips, 10 µL, VWR 76322-132 Pipette...the bottom of the gel. Place the gel in the electrophoresis chamber and secure it. Note: Check the manufacturer...

  4. Protocol - How to Run an Agarose Gel

    Type
    Protocol
    ... Protocols Agarose Gel Electrophoresis Agarose Gel Electrophoresis You may also like... Restriction...DNA from an Agarose Gel DNA Ligation Introduction Gel electrophoresis is the standard lab procedure for ...towards the positive electrode. Always Run to Red. Turn OFF power, disconnect the electrodes from the power ...Standard protocol for performing agarose gel electrophoresis, including tips to improve resolution and separation...pairs) for visualization and purification. Electrophoresis uses an electrical field to move the negatively...through an agarose gel matrix toward a positive electrode. Shorter DNA fragments migrate through the gel...protocol video below to learn how to perform gel electrophoresis. Equipment Casting tray Well combs Voltage ...

  5. Protocol - pLKO.1 – TRC Cloning Vector

    Type
    Protocol
    ...Addgene Plasmid Description pLKO.1 – TRC control Negative control vector containing non-hairpin insert. ...serum-free media Invitrogen: #31985 Dulbecco’s Modified Eagle Medium (DMEM) Invitrogen: #11995 Fetal Bovine...Bovine Serum (FBS) Invitrogen: #16000 Penicillin/Streptomycin Invitrogen: #15140-122 Polypropylene tubes...the TRC for expression of shRNAs. pLKO.1 can be introduced into cells via direct transfection, or can be...subsequent infection of a target cell line. Once introduced, the puromycin resistance marker encoded in pLKO...sites in place of the stuffer. The AgeI site is destroyed in most cases (depending on the target sequence.... pLKO.1 – scramble shRNA Negative control vector containing scrambled shRNA. psPAX2 Packaging plasmid...

  6. Affinity Purification of Recombinant Antibodies with Protein A or Protein G

    Type
    Protocol
    ...Pipette controller Benchtop centrifuge compatible with 50 mL conical tubes NanoDrop spectrophotometer 37 °...Immunocytochemistry Protocol Western Blot Protocol Introduction This protocol describes how to affinity purify...concentration of each fraction on the NanoDrop Spectrophotometer using the A280 IgG setting. Combine all eluates...concentration of the pooled sample on the NanoDrop Spectrophotometer using the A280 IgG setting. If the concentration...Determine antibody concentration on the NanoDrop Spectrophotometer. Dilute antibody to 1 mg/mL with PBS if needed...to check the concentration on the NanoDrop Spectrophotometer to see if the sample has reached the desired...Periodically check the concentration on the NanoDrop Spectrophotometer to see if the sample has reached the desired...

  7. Antibody Validation Using the Indirect ELISA Method

    Type
    Protocol
    ...of each well at 450 nm on the spectrophotometer. Use the spectrophotometer to generate a standard curve...Antibody Purification Protocol Antibody Guide Introduction This protocol describes how to run an indirect...antibody incubation and plate read Tips and Troubleshooting The optimal concentration of primary antibody...an automated ELISA plate washer. Equipment Spectrophotometer compatible with 96-well plates 1–10 µL single...Multichannel pipette reagent reservoirs Pipette controller Microcentrifuge Microplate shaker ELISA plate... antigen Purified recombinant antibody Isotype control antibody HRP-conjugated isotype-specific secondary...mix. Dilute the primary antibody and an isotype control antibody to the desired concentrations in the antibody...

  8. Protocols for Molecular Biology, Plasmid Cloning, and Viral Preps

    Type
    Protocol
    [email protected] with any questions. Intro to the Lab Bench Introductory techniques designed to help you get...Antibodies Protocols for common antibody applications. Intro to the Lab Bench Name Description (Link opens in...Quantification Measure DNA concentration with a spectrophotometer Restriction Digests Cut and analyze plasmid...plasmid DNA with restriction enzymes Agarose Gel Electrophoresis Separate DNA by size on an agarose gel Watch...DNA using DNA ligase Bacterial Transformation Introduce DNA into a bacterial strain Watch the Video! CRISPR...Description Link to Video General Transfection Introduce plasmid DNA to mammalian cells Lentivirus Production...Antibodies Name Description Link to Video Transfection Introduce plasmid DNA to mammalian cells to produce antibodies...

  9. Protocol - Bacterial Transformation

    Type
    Protocol
    ...DNA Ligation Introduction Transformation is the process by which foreign DNA is introduced into a cell....should also add a positive control (many companies include a positive control plasmid with their competent...ligation of inserts to vectors than for an intact control plasmid. Incubate the competent cell/DNA mixture...transform large plasmids, it is a good idea to use electro-competent cells. Instead of relying on the heat-shock...heat-shock to cause the cells to take up the DNA, an electro-magnetic field is applied to the cell/DNA mixture... do this you will need to have access to an electroporator and the appropriate cuvettes. Follow the manufacturer's...

  10. Protocol - How to Ligate Plasmid DNA

    Type
    Protocol
    ...and FAQ Do controls When doing ligations you should ALWAYS do a vector alone + ligase control. This will...ligation. Additional controls are encouraged, but may only be required for troubleshooting failed ligations...The following table indicates the various controls: Control Ligase Interpretation Uncut vector - Checks...know has only been thawed once before. Always do controls. See Tips and FAQ below for details. Try different...treated, that the phosphatase treatment worked. This control should, in principle, be free of colonies, but ...

  11. DNA Quantification

    Type
    Protocol
    ...purity. This can be done with a spectrophotometer. A spectrophotometer uses the absorbance/transmission... instructions for the spectrophotometer specific to your lab. Spectrophotometer Tips Before measuring ...labs have a NanoDrop, which is a very small spectrophotometer that can accurately read DNA concentration...measuring any samples, be sure to ‘blank’ the spectrophotometer using the solution the DNA is resuspended in, ...NanoDrop. It is a good idea to re-zero any spectrophotometer between samples if they are expected to vary...

  12. Plasmid Cloning by PCR (with Protocols)

    Type
    Protocol
    ...an uncut sample of each vector to help with troubleshooting if your digests don’t look as you expected....product is the anticipated size and that your band is strong (indicating that the PCR reaction worked and that...insert. It is also important to set up negative controls in parallel. For instance, a ligation of the recipient...much less total DNA (<1ng) or if you are having trouble getting colonies, you might want to use higher ...to be very large (>10kb) you might want to use electro-competent cells instead of the more common chemically-competent...plasmid alone plate. The recipient plasmid alone control will tell you your “background” level or more specifically...see any colonies, you should conduct a positive control to ensure that your transformation worked. You ...

  13. Protocol - How to Perform a Diagnostic Digest

    Type
    Protocol
    ...Restriction Digest of Plasmid DNA Agarose Gel Electrophoresis Introduction Restriction enzymes are naturally occurring...and analyze the resulting fragments by gel electrophoresis . The pattern of the fragments on the gel can...to analyze a restriction digest. Equipment Electrophoresis chamber Pipetman Pipet tips Reagents Liquid...manufacturer's instructions) Gel loading dye Electrophoresis buffer Verifying Total Plasmid Size -OR- Insert...avoided. If you do have to do so, there is no way to control which orientation the insert is ligated into the... tricks see the Restriction Digest and Gel Electrophoresis pages....

  14. Plasmid Cloning by Restriction Enzyme Digest (with Protocols)

    Type
    Protocol
    ... uncut sample of each plasmid to help with troubleshooting if your digests don’t look as you expected....insert. It is also important to set up negative controls in parallel. For instance, a ligation of the recipient...much less total DNA (<1ng) or if you are having trouble getting colonies, you might want to use higher ...to be very large (>10kb) you might want to use electro-competent cells instead of the more common chemically-competent...plasmid alone plate. The recipient plasmid alone control will tell you your “background” level or more specifically...see any colonies, you should conduct a positive control to ensure that your transformation worked. You ...depending on the number of background colonies on your control plate (the more background, the more colonies you...

  15. Western Blot

    Type
    Protocol
    ...channel pipette Pipette controller Pipette tips and pipettes Spectrophotometer Heat block Mini gel tank...Protocol Recombinant Antibody Purification Protocol Introduction Western blot is a technique used to separate...ladder. Place the lid on the tank and plug the electrode cords into the power supply. Run the gel at 100... a dark room to detect the bands. Tips and Troubleshooting The optimal lysis buffer will vary depending...as expected and is specific, include a positive control sample that you know expresses the protein, such...transfected with the protein of interest, and a negative control sample that does not express the protein of interest...

  16. Lentivirus ddPCR Titration

    Type
    Protocol
    ...Viral Service Lentivirus Guide Virus Blog Posts Introduction This protocol describes how to use droplet digital...ribonuclease P/MRP 30 kDa subunit (RPP30) are used as a control for normalization. The dilution series outlined...wells containing the virus and the untransduced control. Pro-Tip For even seeding, prepare a batch for ...Determine the concentration of each sample on a spectrophotometer. Prepare 25 ng/µL stocks of each sample. Samples...calculate the final infectious titer. Tips and Troubleshooting We recommend wiping down all pipettes and equipment...concentration of RRE positive droplets in the untransduced control should be close to zero (A01). In this protocol...

  17. Sequencing Primers

    Type
    Guide
    ...beta-globin intron, forward primer Bglob-intron-R TTTGCCCCCTCCATATAACA Rabbit beta-globin intron, reverse...TAGAAGGCACAGTCGAGG (Invitrogen) Bovine growth hormone terminator, reverse primer Bglob-intron-F CTGGTCATCATCCTGCCTTT...CCCAGTCACGACGTTGTAAAACG (Invitrogen) In lacZ gene M13/pUC Reverse AGCGGATAACAATTTCACACAGG (Invitrogen) In lacZ gene...AAATGATAACCATCTCGC (Invitrogen) Polyhedrin promoter, forward primer Polyhedrin reverse GTCCAAGTTTCCCTG (Invitrogen) For...Used Primers CMV Forward CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward ...Full Primer List 3'AOX1 GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1 terminator, reverse...reverse primer 5'AOX1 GACTGGTTCCAATTGACAAGC (Invitrogen) For Pichia vectors with AOX1 promoter, forward...

  18. Lentiviral Vector Guide

    Type
    Guide
    ... Versus Gamma-Retrovirus Lentiviruses and gamma-retroviruses fall under the Retroviridae family. The genome...Glossary Lentiviruses are a type of retrovirus and belong to the Retroviridae family. Infection with lentiviruses...variety of cell types than retroviruses. Both lentiviruses and gamma-retroviruses use the same packaging ...packaged by gamma-retroviral packaging systems, and vice versa. For more about gamma-retroviruses, see Addgene's...Panch, S. R., Jin, P., & Stroncek, D. F. (2022). Genome-wide profiling of retroviral DNA integration and its..., leading to disease. Lentivirus A retrovirus from the Retroviridae family. Characterized by long incubation...BIV), and feline immunodeficiency virus (FIV). Retroviruses are partially characterized by their ability...

  19. Immunocytochemistry

    Type
    Protocol
    ...Protocol Recombinant Antibody Purification Protocol Introduction Immunocytochemistry is a technique that uses...Day 3-4: Fix and label cells Equipment Pipette controller Pipette tips and pipettes Rocking platform Tweezers... appropriate fluorescent filters. Tips and Troubleshooting The optimal fixation method will vary depending...functioning as expected and specific, include a positive control sample that you know expresses the protein, such...express the protein of interest, and a negative control sample such as cells that do not express the protein...

  20. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...studied, and has a broad tissue tropism. Table 1 gives a summary of the tropism of AAV serotypes, indicating...variant able to display neuronal retrograde transport, AAVrg. Retrograde transport refers to the direction...disease, spinal muscular atrophy, hemophilia A and B, and Duchenne muscular dystrophy. Many clinical trials...injection. Different AAV serotypes exhibit strong neuronal tropism, meaning they can efficiently target specific...therefore non-pathogenic and generally do not trigger a strong immune response. These features have made AAVs ...are transfected into cells which then act as in vitro factories for the new viral particles in the laboratory...serotypes are AAV variants that differ in their tropism — that is, the types of cells they infect. Serotypes...

  21. Antibody Guide

    Type
    Guide
    ...negative control. The negative control may be a no-antibody control in which a sample is processed without ...standard curve can serve as the positive control); and a negative control, a sample known not to contain your...interest. The negative control should be biological (no protein expressed), which controls for your antibody...fragmentation of the DNA. Controls for capture methods Capture methods should use a positive control and a negative...addition to the control used in standard IP, ChIP should additionally use a beads-only control which runs ...the machine. Controls for cell sorting methods Flow cytometry requires a negative control, a small subset...animal’s immune system. The antigen of interest is introduced to the animal, which then mounts an immune response...

  22. Colony Formation Titering Assay

    Type
    Protocol
    ...Virus Blog Posts Mol Bio Protocols Viral Service Introduction This protocol can be used to titer lentivirus...titer of your lentiviral preparation allows you to control the multiplicity of infection (MOI) in downstream...channel pipette Ice bucket CO 2 incubator Pipet controller Hazardous waste container Reagents DMEM high ...All of the cells in the untransduced (negative) control well should be killed and no colonies should be...appropriate antibiotic. When the untransduced (negative control) cells have died and colonies are visible in the...

  23. Optogenetics Guide

    Type
    Guide
    ...Optogenetics Guide Introduction Microbial Opsins Optical Switches References Introduction The field of optogenetics...research utilize light to detect, measure, and control molecular signals and cells in order to understand... genetically-encoded tools for light-activated control of proteins; e.g., microbial opsins and optical...These various opsins also initiate different electrochemical responses, such as nonspecific cation influx...subsets of neurons, allowing precise spatiotemporal control of these neurons by turning on and off the light...Wild-type halorhodopsin, known as NpHR (from Natronomonas pharaoni ), causes hyperpolarization (inhibition.../NpHR Light-driven inward chloride pump from Natronomonas pharaonis , used to silence neuronal activity...

  24. Kit Free RNA Extraction

    Type
    Protocol
    ...Gel Purification Molecular Biology Reference Introduction This protocol describes how to extract RNA from...unlike using a p1000 tip it will give you more control of where you’re aiming your tip in the tube. Precipitate...the quality of your RNA sample(s) using a spectrophotometer (such as a Nanodrop), agarose gel, or bioanalyzer...

  25. Molecular Biology Reference

    Type
    Guide
    ...is also important for controlling the level of insert expression (i.e., a strong promoter directs high...BL21 Invitrogen; New England BioLabs E. coli B F dcm ompT hsdS(rB mB) gal ccdB Survival Invitrogen F- mcrA...Genetics Plasmid Elements Working with Plasmids Introduction Types of Plasmids E. coli strains for propagating...genes as carriers of phenotypic information was introduced in the early 19th century by Gregor Mendel, who...of restriction enzymes, DNA ligase, and gel electrophoresis allowed for the ability to move specific fragments...that the antibiotic resistance gene is under the control of a bacterial promoter, and is thus expressed ...antibiotic resistance gene (this time, under the control of a non-bacterial promoter) or a fluorescent protein...

  26. Protocol - How to Purify DNA from an Agarose Gel

    Type
    Protocol
    ...gel electrophoresis, which separates DNA by their length in base pairs. Following electrophoresis, you...Restriction Digest of Plasmid DNA Agarose Gel Electrophoresis DNA Ligation Background Information Gel purification...Protocol: Gel Purification Follow the Agarose Gel Electrophoresis Protocol with the following amendments: Notes...

  27. Video Library

    Type
    Protocol
    ... Technology Protocol Agarose Gel Electrophoresis Gel electrophoresis is the standard laboratory procedure...visualization and purification. Agarose Gel Electrophoresis Protocol Purifying DNA from an Agarose Gel ...DNA fragments based on size. Following gel electrophoresis, you can cut DNA bands out of the agarose gel...

  28. Promoters

    Type
    Guide
    ...Transcription is tightly controlled in both bacteria and eukaryotes. Promoters are controlled by various DNA regulatory...Constitutive Strong mammalian promoter from human cytomegalovirus EF1a Constituitve Strong mammalian promoter...vital component of expression vectors because they control the binding of RNA polymerase to DNA. RNA polymerase...a functional protein. Thus the promoter region controls when and where in the organism your gene of interest... are proteins which recruit RNA polymerase and control and regulate the transcription of DNA into mRNA...human elongation factor 1 alpha CAG Constitutive Strong hybrid mammalian promoter PGK Constitutive Mammalian...consists of the sequence TTGACA and this element controls the rate of transcription. Bacterial cells contain...

  29. Fluorescence Titering Assay

    Type
    Protocol
    ...Virus Blog Posts Mol Bio Protocols Viral Service Introduction This protocol can be used to titer lentiviral... titer of your lentiviral vector allows you to control the multiplicity of infection (MOI) in downstream...channel pipette Ice bucket CO 2 incubator Pipet controller Hazardous waste container Inverted fluorescence...dilution with one well remaining as the untransduced control). Count the cells in the remaining well, a cell...

  30. Adenovirus Guide

    Type
    Guide
    ...Addgene's Blog An Introduction to Adenovirus Adenoviral Vector Production and Troubleshooting Adenoviral Delivery...recognizes adenoviral elements rapidly and can mount a strong immune response quickly, which has limited their...double-stranded circular episomes. Due to this, and to the strong host’s immune response against the transduced cells...G). Different serotypes exhibit varying tissue tropisms, meaning they preferentially infect certain tissues...proteins. Researchers have further refined the tropism of rAdV vectors by mixing capsids and genomes from...vector features such as transduction efficiency, tropism and immunogenicity. For example, Ad5/35 and Ad5...viral vector uptake and transgene expression. This strong immune response has become a disadvantage for the...

  31. Molecular Biology Protocol - Restriction Digest of Plasmid DNA

    Type
    Protocol
    ...Purifying DNA from an Agarose Gel DNA Ligation Introduction Restriction enzyme digestion takes advantage...your restriction digest results. Equipment Electrophoresis chamber Pipetman Reagents Liquid DNA aliquot...manufacturer's instructions) Gel loading dye Electrophoresis buffer Pipet tips Procedure Select restriction...visualize the results of your digest, conduct gel electrophoresis . Tips and FAQ Restriction enzymes MUST be ...

  32. CRISPR Guide

    Type
    Guide
    ...provide a basic understanding of CRISPR biology, introduce the various applications of CRISPR, and help you...research. CRISPR Basics In this section, we will introduce the basic mechanisms of CRISPR and some of the...increase nuclease fidelity SpCas9-NG - NG; increase in vitro activity SpG - NGN; increase nuclease activity SpRY...-occurring Acr (Anti-CRISPR) proteins can help control CRISPR activity. Acr proteins have evolved in phages...LmoCas9 and SpCas9. Acr proteins can be used to control both when and where genome editing happens. CASANOVA...Dominik Niopek’s lab , is a way to optogenetically control genome editing by fusing the anti-CRISPR protein...photosensitive LOV2 domain . Several labs have also controlled Acr activity with endogenous cell-type specific...

  33. Using a Light Microscope Protocol

    Type
    Protocol
    ...Using a Light Microscope Using a Light Microscope Intro to the Lab Bench Check out more protocols and videos...videos to help you get started in the lab! Introduction Microscopes are emblematic of biological research... cheap and accessible) to massive transmission electron microscopes that allow us to see cellular components...resolution when your image is in focus, which you can control using the focus knobs on the side of the microscope...

  34. Virus Protocol - Generating Stable Cell Lines

    Type
    Protocol
    ...Virus Blog Posts Mol Bio Protocols Viral Service Introduction This protocol can be used to generate stable...channel pipette Ice bucket CO 2 incubator Pipet controller Hazardous waste container Reagents DMEM high ...plate will hold 5 dilutions plus one 'no virus' control well). Perform a "reverse transduction" by seeding...selection should last at least as long as it takes the control (untransduced) cells to completely die. After that...

  35. Chemogenetics Guide

    Type
    Guide
    ... However, neuronal control through PSAMs and LMOs is direct, while neuronal control of DREADDs is indirect...endogenous signaling, therefore allowing precise control over the cell population they are targeted to. ...used in the same organism to allow bidirectional control of neuronal activity. Table 1. Descriptions of ...chemogenetic receptors that confer more direct control of neurons through manipulation of ion channels...expression of AAV-delivered constructs can be controlled with cell-type specific promoters. Table 4 lists...unwanted cell types. Generating a FLEx switch to control expression of a chemogenetic reporter ensures that...AI, Armbruster BN, Pei Y, et al. (2009). Remote control of neuronal activity in transgenic mice expressing...

  36. Isolating a Monoclonal Cell Population by Limiting Dilution

    Type
    Protocol
    ...express Cas9 and are included as a control (WT). Vinculin is a loading control. 1 lentiCas9-Blast was a gift...Virus Blog Posts Addgene Protocols Viral Service Introduction This protocol describes how to generate a monoclonal...µL single channel pipette CO 2 incubator Pipet controller Hazardous waste container Microscope Hemocytometer...

  37. Guide to Using Pooled Libraries

    Type
    Guide
    ...Library Guide Introduction Library Amplification Types of Screens Resources An Introduction to Pooled Libraries...the screening process. Amplify the library (electroporation and maxiprep). If delivering as virus, make... Perform Next Generation Sequencing (NGS) on a control sample (no selection) In parallel, apply library...cells Compare NGS results between experimental and control cells Generate a list of gRNAs that disappear with... post-selection. The selective pressure must be strong enough that most of the cells die, removing their...selection while the other serves as a non-selected control. These two populations are then sequenced using...Screening Pooled CRISPR Libraries Offer Genome-Wide Control for Large-Scale Functional Screens New Tool for...

  38. Plan Your Experiment

    Type
    Guide
    ...viral delivery RNA delivery of Cas9 and gRNA In vitro transcription reactions generate mature Cas9 mRNA... to target cells through microinjection or electroporation Transient expression of CRISPR components Expression...ribonucleoprotein (RNP) complexes Purified Cas9 protein and in vitro transcribed gRNA are combined to form a Cas9-gRNA...repaired DSBs): For small nucleotide edits that introduce a novel restriction site. The region of interest...identify DNA fragments. PCR amplification and gel electrophoresis (for HDR or NHEJ): For large deletions or insertions...25408407 Hashimoto, M., & Takemoto, T. (2015). Electroporation enables the efficient mRNA delivery into the...enables efficient protein-based genome editing in vitro and in vivo. Nature Biotechnology . 33 (1), 73–80...

  39. Protocol - How to Perform Sequence Analysis

    Type
    Protocol
    ...Design a Primer Diagnostic Restriction Digest Introduction Sequence verification of important plasmid features... do not sequence the entire plasmid. Addgene strongly recommends that you sequence any portion of the...What primers were used by Addgene during quality control? Addgene lists the primers used to obtain each ...

  40. Ligation Independent Cloning

    Type
    Protocol
    ...cloning scars"). A “stuffer” sequence allows for electrophoretic separation of linearized vector from the reaction...linearized vector from the reaction mixture by gel electrophoresis followed by gel purification . The cut vector... your chances of success. Set up a vector only control with water instead of the insert. Incubate the ...

  41. Centrifugation

    Type
    Protocol
    ...Protocols Centrifugation Centrifugation Protocol Intro to the Lab Bench Check out more protocols and videos...videos to help you get started in the lab! Introduction A centrifuge is a common piece of laboratory equipment...the rotor with microfuge tubes in place, and the control panel where you can set the time and speed needed...

  42. Lab Safety for Biosafety Levels One and Two

    Type
    Protocol
    ... Biosafety Levels One and Two (BSL-1 and BSL-2) Intro to the Lab Bench Check out more protocols and videos...videos to help you get started in the lab! Introduction There are four biosafety levels. This protocol...protocols require bloodborne pathogens training. It is strongly recommended that anyone participating in BSL-2...

  43. Gibson Assembly Protocol

    Type
    Protocol
    ...and 30 bp annealing to the target sequence. Avoid strong secondary structures in the homology region. Hairpins...seams between the assembled parts. Tips and Troubleshooting “Stitching” fragments together using oligos...oligos. This technique is especially useful for introducing promoters, terminators, and other short sequences...

  44. Lentivirus Production

    Type
    Protocol
    ...like... Viral Vector Guides Mol Bio Protocols Introduction This protocol can be used to produce lentivirus...channel pipette Ice bucket CO 2 incubator Pipet controller Hazardous waste container pH meter Stir plate... should be aliquoted and snap frozen in liquid nitrogen and stored at -80 °C as soon as possible to avoid...

  45. Science Guides

    Type
    Guide
    ...selectively control and investigate cell signaling pathways. Receptors are remotely controlled via small...small molecules, which allows for specific control of activity. Read More CRISPR Class 2 C lustered R egularly...research utilize light to detect, measure, and control molecular signals and cells in order to understand...Lentivirus Adeno-associated Virus (AAV) Adenovirus γ-Retrovirus Read More...

  46. Handling Plasmids from Addgene - Purifying Plasmid DNA

    Type
    Protocol
    ...like... Bacterial Transformation Agarose Gel Electrophoresis Agarose Gel DNA Purification Streaking and ...Bacteria Inoculating a Liquid Bacterial Culture Introduction Many molecular biology techniques require highly...window) Qiagen , (Link opens in a new window) Invitrogen , and (Link opens in a new window) Promega sell...

  47. What is Polymerase Chain Reaction (PCR)

    Type
    Protocol
    ...standard Polymerase Chain Reaction (PCR) is an in vitro method that allows a single, short region of a DNA...product can be verified based on size by gel electrophoresis . Protocol Video Watch the protocol video below...to each reaction. The ideal setup for this troubleshooting step is to do one reaction with each, and one...

  48. Addgene's eBook Collection

    Type
    Guide
    ...biosensors, and monitoring protein localization; an introduction to non-protein fluorophores; and much more! ...About This guide to viral vectors contains an introduction to each vector and its applications, tips for...for using vectors in your experiments, troubleshooting advice on production and use, and much more! Close...Edition, trans. About Una traducción al español de nuestro libro electrónico, CRISPR 101. Close About Overlay...Edition About Our newest eBook contains practical introductions and helpful tips for antibody-based applications...

  49. AAV Titration by qPCR Using SYBR Green Technology

    Type
    Protocol
    ...Vector Guides Virus Blog Posts Mol Bio Protocols Introduction The AAV Titration protocol can be used to determine...samples being tested. Always include a No Template Control (NTC), i.e master mix + water Whenever possible...duplicate. Do not forget to include a no template control ( NTC = master mix + water ). Add 15 μL of Master...
Showing: 851 - 900 of 916 results