We narrowed to 1,054 results for: STI

...ensure that you are in compliance with your institution’s biosafety regulations. Last Update: July 7, ... µg/mL. Mix well and incubate 72 h. Benzonase Digestion and Cell Harvest Gently aspirate media from the... When analyzing data there should be a clear distinction between negative droplets (black) and positive...

...to drive constitutive or inducible expression. Promoter Expression Description T7 Constitutive Promoter...polymerase Sp6 Constitutive Promoter from Sp6 bacteriophage; requires Sp6 RNA polymerase lac Constitutive Promoter...tryptophan operon Ptac Constitutive Hybrid promoter of lac and trp; constitutive in the absense of lac ...Drosophila Polyhedrin Constitutive Insect Strong promoter from baculovirus CAG Constitutive Mammalian Strong...promoter CMV Constitutive Mammalian Strong promoter from human cytomegalovirus EF1a Constituitve Mammalian... alpha PGK Constitutive Mammalian Promoter from phospholycerate kinase gene U6 Constitutive Mammalian ...) CaMV35S Constitutive Plant Strong promoter from Cauliflower Mosaic Virus Ubi Constitutive Plant High-expression...

...way to stimulate the activity of a particular GPCR is to engineer a chimeric protein consisting of an ...other fragment to CIB1, light-stimulated heterodimerization can reconstitute the protein. This principle... 450 OPTOSTIM PHR domain of CRY2 from A. thaliana is fused to truncated forms of cytosolic STIM1 to control...neurons upon exposure to light through direct stimulation of ion channels. Naturally occurring channelrhodopsins... nonspecific cation influx into the cell when stimulated. Channelrhodopsin-2 (ChR2), the first widely ...domains from two different ChRs. These ChR variants still function as light-gated cation channels resulting...physiological processes in response to specific stimuli. In fact, the animal GPCRs responsible for vision...

...oligonucleotide stitching, in which pieces of DNA that share no homology ends can still be fused in a seamless...Ligation Independent Cloning Yeast-Mediated & Oligo Stitching Resources Molecular cloning, or the creation of...containing precise 5' or 3' single-strand overhangs (sticky ends), or no overhang (blunt ends). Two pieces ...is done via a single recombination reaction, drastically simplifying the process and reducing the amount...rapidly shuttled into any compatible Gateway destination vector, which contains attR sites, via LR clonase...bacterial recombination to easily move it into any destination plasmid that fits your experimental goal. Although... Gateway donor , Gateway entry , and Gateway destination vectors with different promoters, tags, selection...

...fluorophores to distinguish between cells. Most flow experiments will use one marker to distinguish between live... Minibodies are engineered antibody fragments consisting of two scFvs bound to a CH3 domain. Fab fragments...measurable light or color in response to a specific stimulus, can be conjugated to antibodies in order to allow...machine or by X-ray film. HRP cannot be used to distinguish between different antibodies in the same reaction...the number of signaling molecules that can be distinguished in your application. The indirect detection ...molecule to epitope ratio. Secondary antibodies can distinguish between different species of origin, isotypes...between DNA and protein. Micrococcal nuclease digestion is used to shear the DNA in these assays. This...

...PMID: 25398340 Walton, R. T., Christie, K. A., Whittaker, M. N., & Kleinstiver, B. P. (2020). Unconstrained...Publications CRISPR Overview Bacteria have an interesting adaptive immune response that detects and eliminates...DNA with no homology elsewhere in the genome. Realistically, most gRNA targeting sequences will have additional..., a large portion of the Cas9-induced DSBs will still be repaired via NHEJ. The resulting population of...integrase landing site ( attB ) and the other to stimulate DNA repair. This can result in more efficient ...activity. Knockout libraries often target 5′ constitutively expressed exons, while activation and repression...repression, many CRISPR epigenetic tools require constitutive expression of the dCas9 fusion and/or expression...

...have a biological question in mind. Then you can decide how to answer that question using genetic manipulation...efficiency. So while testing multiple gRNAs is a good idea for most CRISPR experiments, testing multiple pegRNA...your specific application. Knockout : Target constitutively expressed regions, 5’ exons, or an exon known...protocol associated with the specific plasmid in question (see CRISPR protocols from Addgene depositors ...choosing a validation method, ask yourself some questions: Does the resulting population need to be identical... insertions/deletions Very inefficient Can't distinguish specific edits PCR Knockouts Large insertions...Insertions/deletions Prime and base edits HDR Can distinguish between homozygous and heterozygous edits High...

...) Human M3 muscarinic Arrestin-2/-3 CNO Increase Arrestin translocation Arrestin signalling Nakajima &...vivo and the receptors exhibited high levels of constitutive activity, making them less than ideal. DREADDs...insensitivity to endogenous ligands, have low constitutive activity, and their activating ligands have ...G-protein and activate neuronal firing through stimulating phospholipase C, which releases intracellular...This DREADD was shown to have a small amount of constitutive activity, and is not widely used. There is also... also a DREADD that couples to β-arrestin to activate noncanonical GPCR signaling independent of G proteins..., M. E., Lu, D., Barter, J. W., Rossi, M. A., Augustine, G. J., Yin, H. H., & Hochgeschwender, U. (2016...

...for your eyes!), remove it from any gel tray as plastic will block much of the UV and with a clean, sterile... gel on a glass plate if available. Unlike the plastic tray, this will not significantly reduce the UV...

...Plasmid You may also like... How to Design a Primer Diagnostic Restriction Digest Introduction Sequence verification...the peaks in the area and make sure they are justifiable peaks. For instance, in the trace file below...

...recognition sequence. This can create multiple distinct overhangs with a single enzyme, and remove the...now look like this: Note: Elute your purified digestion and PCR products with sterile water (instead of...

...been placed in the centrifuge before you and may still be on the equipment. Before using the centrifuge...centrifuge. Immediately stop the centrifuge and investigate the issue. When you are finished spinning your...

...with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your chosen plasmid...creating first-generation rAdV vectors, which is still the most commonly used generation for research purposes...greater ability to avoid vector-neutralizing pre-existing immunity. Pseudotypes Pseudotyping is the process...developed a serotype-specific immune response. Preexisting immunity lowers viral vector uptake and transgene...vectors are also being used in cancer therapy to stimulate anti-tumor immune response in different ways, ...high titers for their use in experiments. Needle sticks and ripped gloves are common points of entry. Biosafety...office can provide more information on your institution's best practices with regard to AdV research. ...

...the required components have been separated into distinct plasmids for safety. For a summary of all lentiviral...replicate on their own. While the viral components are still separated on different plasmids, the viral genome...with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your chosen plasmid...knowing the general preference for integration, it is still random and difficult to predict. In therapeutic ...particles. However, VSV-G is toxic under long-term, constitutive expression. In order to make stable cell lines...contact to mucous membranes or broken skin. Needle sticks and ripped gloves are common points of entry. Biosafety...office can provide more information on your institution's best practices with regard to lentiviral-related...

...BSL-2). The purpose of the four levels is to distinguish between different types of hazards and to provide...with additional precautions to prevent injuries, ingestion, and exposures to hazardous materials. Video Watch...

...with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your chosen plasmid...occur, although at a low frequency which has been estimated to range from 0.01% to 3% depending on cell type...for the treatment of other major diseases such as cystic fibrosis and cancer. Neuronal Tracing Recombinant... splice site donor and acceptor sequences to reconstitute the two pieces of the transgene. The first vector...delivery of larger transgenes, but expression is still much less efficient than with a single rAAV vector...contact to mucous membranes or broken skin. Needle sticks and ripped gloves are common points of entry. Biosafety...office can provide more information on your institution's best practices with regard to AAV-related research...

...these required components have been separated into distinct plasmids for safety to reduce the chance of creating...with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your chosen plasmid...particles. However, VSV-G is toxic under long-term, constitutive expression. In order to make stable cell lines...contact to mucous membranes or broken skin. Needle sticks and ripped gloves are common points of entry. Biosafety...office can provide more information on your institution's best practices with regard to gamma-retroviral-related...10.3390/v13081471 PMID: 34452336 Schnierle, B. S., Stitz, J., Bosch, V., Nocken, F., Merget-Millitzer, H....Some newer plasmids use a hybrid 5' LTR with a constitutive promoter such as CMV or RSV. 3' LTR in cis Terminates...

...thousand base pairs from the entire human genome. Digesting the human genome with restriction enzymes would...are now used for a variety of studies used to investigate promoters, small RNAs, and other genetic elements...enabling easy insertion of DNA by restriction enzyme digestion and ligation. As a general rule, the restriction...gram-negative, rod-shaped bacteria naturally found in the intestinal tract of animals. There are many different naturally...over multiple generations. It is important to distinguish that the antibiotic resistance gene is under ...with a different fluorophore so they can be distinguished from one another. These tagged dNTPs also lack...is not 100% efficient and the machine cannot distinguish between the four labeled nucleotides, or in biologically...

...iAChSnFR none Constitutive 1 Loren Looger 137955 pAAV.CAG.iAChSnFR CAG iAChSnFR none Constitutive 1 Loren Looger...none Constitutive 1 Yulong Li 153286 pAAV-hsyn-GRAB_Ado1.0med Syn GRAB Ado1.0med none Constitutive 2 Yulong...none Constitutive 1, 9 Loren Looger 179254 AAV-CAG-jGCaMP8f-WPRE CAG jGCaMP8f none Constitutive 1, 9, ...none Constitutive 1, 9 Loren Looger 179256 AAV-CAG-jGCaMP8s-WPRE CAG jGCaMP8s none Constitutive 1, 9, rg... CN4871) minBG RiboL1-jGCaMP8s none Constitutive 1 Allen Institute for Brain Science , Jonathan Ting Calcium...none Constitutive 1, 5, 9 Loren Looger 176757 AAV-EF1a-jGCaMP8m-WPRE EF1a jGCaMP8m none Constitutive 1, 9...jGCaMP8m none Constitutive 1, 9, rg* Loren Looger 210400 PRS_8-GCaMP8m PRS jGCaMP8m none Constitutive 2 Simon...

...gfaABC1D tdTomato Constitutive 5 Baljit Khakh 50465 pAAV-hSyn-EGFP hSyn EGFP Constitutive 1, 2, 5, 8, 9, ...tdTomato Constitutive 5 Hongkui Zeng 58909 pAAV-GFAP104-mCherry GFAP104 mCherry Constitutive 5 Edward ...c-Fos EYFP Constitutive 1 Brandon Harvey 59462 pAAV-CAG-tdTomato CAG tdTomato Constitutive 1, 2, 5, 8,...PI.eGFP.WPRE.bGH GFA104 EGFP Constitutive 5 Philip Haydon 104055 pAAV-CAG-eYFP CAG EYFP Constitutive 2, 5, rg*, PHP....NLS-GFP Constitutive PHPeB Viviana Gradinaru 116869 pAAV-CAG-H2B-GFP CAG H2B-GFP Constitutive rg* Loren...H2B-tdTomato Constitutive rg* Loren Looger 105530 pAAV.CMV.PI.EGFP.WPRE.bGH CMV EGFP Constitutive 1, 2, 5,...ffLuciferase Constitutive 8 James M. Wilson 105534 pAAV.TBG.PI.LacZ.bGH TBG LacZ Constitutive 8 James M....

...Venus Constitutive 1, 9 Karel Svoboda 58892 pAAV-GFAP104-ChR2-mCherry GFAP ChR2 mCherry Constitutive 5 Edward...mScarlet Constitutive 9 Christopher Harvey 59170 pAAV-Syn-Chronos-GFP Syn Chronos GFP Constitutive 1, 5, ...ChETA EYFP Constitutive 9 Karl Deisseroth 135633 pAAV-S5E2-C1V1-eYFP E2 C1V1 EYFP Constitutive 1, 5, 9, ...mCherry Constitutive 8 Roger Tsien 99039 pAAV-CamKII-ArchT-GFP (PV2527) CaMKII ArchT GFP Constitutive 1, 5...EYFP Constitutive 2, 5 Karl Deisseroth 137151 pAAV-nEF-NpHR3.3-EYFP nEF NpHR 3.3 EYFP Constitutive 8 Karl...dependent Flp dependent Cre and Flp dependent Constitutive Serotype AAV1 AAV2 AAV5 AAV8 AAV9 AAVrg PHPeB...pAAV-mDlx-ChR2-mCherry-Fishell-3 Dlx ChR2 mCherry Constitutive 1, 9, rg* Gordon Fishell 135634 pAAV-S5E2-ChR2...

...titers were similar to those reported by these institutions. This protocol is for a 96-well plate with 20...reaction volume. Last Update: February 13, 2019 Estimate of time required: ~3 h Workflow Timeline Plate...

...should be properly disposed of following your institution’s hazardous waste procedures. Last Update: February...desired concentration. If the sample concentration is still too low, repeat the centrifugation until the volume...

...ensure that you are in compliance with your institution’s biosafety regulations. Equipment Class II, Type... When analyzing data there should be a clear distinction between negative droplets (black) and positive...

...entire tube is dried but while the white pellet is still visible. Resuspend RNA pellet in RNase-free water...

... experimental design, biosensors can enable investigation of a signaling pathway or measurement of a biomolecule...a biosensor in a novel context or modifying an existing construct, as fluorescence properties can be affected...Fast Genetically Encoded Calcium Indicators (Constitutive or Cre-dependent) jGCaMP8 Fast Genetically Encoded...High-performance GFP-based calcium indicators (Constitutive or Cre-dependent) High-performance calcium sensors...calcium sensors for imaging neural activity (Constitutive or Cre-dependent) Ultrasensitive fluorescent...regulatory element Viral manipulation of functionally distinct interneurons in mice, non-human primates and humans...Yellow protein calcium sensor jYCaMP1 variants (Constitutive or Cre-dependent) jYCaMP: an optimized calcium...

...pCAG-T7-TALEN(Sangamo)-Destination Pawel Pelczar pCAG-T7-TALEN(Sangamo)-Destination constructs were designed...TALEN(Sangamo)-FokI-KKR-Destination 40132 pCAG-T7-TALEN(Sangamo)-FokI-ELD-Destination Golden Gate TALEN 2.0...pC-GoldyTALEN and RCIsricpt-GoldyTALEN are designed as destination vectors for the Voytas lab Golden Gate TALEN ...-BB and pTAL6-BB are designed as alternative destination vectors for the Golden Gate TALEN kit (Bogdanove... pTAL6-BB contains the TEF1 promoter, giving constitutive expression of TALORs built into this vector....several later studies. pCAG-T7-TALEN(Sangamo)-Destination vectors are available with homodimeric or enhanced...accessory pack contains modified pFUS array vectors, destination vectors and a reporter vector for mammalian cell-based...

...p15TV-L EF456736 Hexahistidine tag with TEV cleavage, AmpR 26093 pET15-MHL EF456738 Hexahistidine tag with TEV...GST-tag and hexahistidine tag with Thrombin cleavage, KanR 26096 pET28-MHL EF456735 Hexahistidine tag with...26117 pNIC-CH EF199843 Hexahistidine tag, AmpR 26103 pNIC28-Bsa4 EF198106 Hexahistidine tag with TEV cleavage...EF199844 Hexahistidine tag, FLAG tag with TEV cleavage, KanR 26106 pNH-TrxT GU269914 Hexahistidine tag, thioredoxin...GU452710 Hexahistidine tag , Z-basic, TEV cleavage, AmpR 26108 pFB-LIC-Bse EF199842 Hexahistidine tag with...TEV cleavage, AmpR 26094 pET28a-LIC EF442785 Hexahistidine tag with Thrombin cleavage, KanR 26101 pET28GST-LIC...ptac promoter, AmpR 26099 pFBOH-LIC EF456740 Hexahistidine tag with Thrombin cleavage, Bac-to-Bac Baculovirus...

...Activity Serotype PI 99118 pAAV-CAG-tTA CAG-driven, constitutive Expression of the tet-off transactivator (tTA...34910 paavCAG-pre-mGRASP-mCerulean CAG-driven, constitutive Expression of pre-synaptic mGRASP-mCerulean ...34912 paavCAG-post-mGRASP-2A-dTomato CAG-driven, constitutive Expression of post-synaptic mGRASP-dTomato for...AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA CMV-driven, constitutive Expression of human codon-optimized Cas9 from...Feng Zhang 85450 pAAV-RSV-SpCas9 RSV-driven, constitutive Expression of SpCas9. 8 Hetian Lei 104588 pAAV-EFS-SpCas9...pAAV-EFS-SpCas9 EFS-driven, constitutive Expression of Myc-tagged SpCas9. 8 Ryohei Yasuda Labeling Tools...Serotype PI 149415 pAAV-TBG-ER-TurboID TBG-driven, constitutive Expression of ER-localized TurboID (with HA ...

...chloroplast-specific genetic modules, including destination vectors specific for tobacco ( N. tabacum ) or...Expression Paul Freemont 78 plasmids including constitutive promoters, T7 expression, RBS strength variants...nonfunctional "dummy" parts, 34 backbones, and 6 destination vectors for use in E. coli for a variety of applications...Bacterial Expression Marco Trujillo Plasmids for reconstituting the ubiquitination cascades of different organisms...Takashi Yamamoto Nine pFUS array vectors and destination vectors designed for use with the Golden Gate...

...NETRF-funded investigators listed below. Depositing Principal Investigators (PIs) PI Institution NETRF Project...Meyerson Dana-Farber Cancer Institute Finding the Causes of Small Intestinal Neuroendocrine Tumors Ramesh...Shivdasani Dana-Farber Cancer Institute Epigenetic Regulators of Intestinal Endocrine Cells and Carcinoid...Regulators of Intestinal Endocrine Cells and Carcinoid Tumors Bradley Bernstein Broad Institute Identifying...Project Title Hans Clevers Hubrecht Institute Modeling Neuroendocrine Tumors Using Adult Stem Cell-Derived...Identifying Altered Epigenetic States and Drivers in Intestinal Carcinoid and Pancreatic Neuroendocrine Tumors...

...MGC20661 CSF1 colony stimulating factor 1 (macrophage) MCSF, MGC31930 CSF1R colony stimulating factor 1 receptor...CSF3 colony stimulating factor 3 (granulocyte) G-CSF, GCSF, MGC45931 CSF3R colony stimulating factor 3 receptor...LXA4R FSHB follicle stimulating hormone, beta polypeptide - FSHR follicle stimulating hormone receptor FSHRO...PTP, REG RETN resistin ADSF, FIZZ3, MGC126603, MGC126609, RETN1, RSTN, XCP1 RETNLB resistin like beta FIZZ1...MGC141920 TSHB thyroid stimulating hormone, beta CHNG4, TSH-BETA TSHR thyroid stimulating hormone receptor ...inducible - VIP vasoactive intestinal peptide MGC13587, PHM27 VIPR1 vasoactive intestinal peptide receptor 1 ...presenting its cognate antigen along with co-stimulation activates the T cell, whereas T cell tolerance...

...page Yeast GAL4, PGK, ADH1, ADE2, TRP1 Gateway destination vectors - Inducible expression...vector for ORF expression pDest-565 - Gateway destination vector for bacterial expression; His,GST tag ...N-terminal GST pGCS-N5(GST) - GST tagged Gateway destination vector for mammalian, avian, xenopus, or zebrafish...genome pLenti CMV GFP DEST - Lentiviral Gateway destination vector for gene expression pLenti CMV/TO Zeo ...Zeo DEST - Tet-inducible lentiviral Gateway destination vector for gene expression Lentiviral backbones ...Basic Vector - Firefly luciferase vector for investigating regions controlling transcription See our Luciferase...for cloning in shRNAs, including plasmids for constitutive, conditional (Cre-lox), or inducible (Tet) expression...

...fluorophores to distinguish between cells. Most flow experiments will use one marker to distinguish between live... Minibodies are engineered antibody fragments consisting of two scFvs bound to a CH3 domain. Fab fragments...measurable light or color in response to a specific stimulus, can be conjugated to antibodies in order to allow...machine or by X-ray film. HRP cannot be used to distinguish between different antibodies in the same reaction...the number of signaling molecules that can be distinguished in your application. The indirect detection ...molecule to epitope ratio. Secondary antibodies can distinguish between different species of origin, isotypes...between DNA and protein. Micrococcal nuclease digestion is used to shear the DNA in these assays. This...

...bacteria as model systems to answer many interesting biological questions. Escherichia coli is the most widely...gram-positive bacteria, are also being used for their distinct features. Addgene distributes many plasmids that... Expression It isn’t always advantageous to constitutively express your gene of interest at high levels...36267 pBAD33.1 pBAD Arabinose Escherichia coli Christian Raetz 26098 pCW-LIC 3xPtac Lactose/IPTG Escherichia...106476 pET28a_T5-ARG1 Bacterial cells Ultrasound (acoustic reporter gene, ARG1) Escherichia coli Nissle 1917...106473 pET28a_T7-ARG1 Bacterial cells Ultrasound (acoustic reporter gene, ARG1) Escherichia coli Mikhail ...106474 pET28a_T7-ARG2 Bacterial cells Ultrasound (acoustic reporter gene, ARG2) Escherichia coli Mikhail ...

...CRISPRa Emma Rawlins 72835 pMK243 (Tet-OsTIR1-PURO) Expresses OsTIR1 under the control of a TRE3GS promoter...repurposing endogenous systems that respond to natural stimuli like hormones or metal ions, scientists have adapted... puromycin selection. See Plasmid #85973 for blasticidin and Plasmid #85972 for hygromycin selection. ...Tet-Off vector for repressible expression with blasticidin selection. *Note: this vector contains an insert...Blast (w756-1) Lentiviral Tet-On vector with blasticidin selection. See Plasmid #26730 for hygromycin ...selection. rtTA3 Eric Campeau 128061 pLVX-Tet3G blasticidin Lentiviral Tet-On vector with CMV promoter Tet-On... vector expressing Tet-On 3G transactivator constitutively expressed by EF1a promoter Tet-On 3G rtTA David...

...’s protocol to design your own primers . Still have questions about choosing the best primer for your ...EGFP Reverse EXFP-R GTCTTGTAGTTGCCGTCGTC For distinguishing EGFP vs ECFP vs EYFP Reverse F1ori-F GTGGACTCTTGTTCCAAACTGG...TCTGGGACGTCGTATGGGTA HA tag Reverse HAT GAGGAGCACGCTCATGCCCAC Histidine affinity tag Forward hGH-PA-R CCAGCTTGGTTCCCAATAGA...

...have a biological question in mind. Then you can decide how to answer that question using genetic manipulation...efficiency. So while testing multiple gRNAs is a good idea for most CRISPR experiments, testing multiple pegRNA...your specific application. Knockout : Target constitutively expressed regions, 5’ exons, or an exon known...protocol associated with the specific plasmid in question (see CRISPR protocols from Addgene depositors ...choosing a validation method, ask yourself some questions: Does the resulting population need to be identical... insertions/deletions Very inefficient Can't distinguish specific edits PCR Knockouts Large insertions...Insertions/deletions Prime and base edits HDR Can distinguish between homozygous and heterozygous edits High...

... Standards SynBio Blog Genome Engineering A distinguishing feature of synthetic biology is the ease with...ACTAGT A GCGGCCG CTGCAG Suffix Enzymes: SpeI , NotI , PstI Scar: TACTAGAG or TACTAG Features: 8 bp Scar; No...Prohibited Restriction Sites: EcoRI, XbaI, SpeI, PstI Restriction Sites to Avoid: NotI For more info, ...GCTAGC GCGGCCG CTGCAG Suffix Enzymes: Nhel , NotI , PstI Scar: GCTAGT Features: 6 bp scar encodes Ala-Ser...Prohibited Restriction Sites: EcoRI, SpeI, NheI, PstI Restriction Sites to Avoid: PvuII, XhoI, AvrII, ...ACTAGT A GCGGCCG CTGCAG Suffix Enzymes: SpeI , NotI , PstI Scar: ACTAGA Features: Modified RFC 10 with shortened...Prohibited Restriction Sites: EcoRI, XbaI, SpeI, PstI For more info, visit iGEM: Silver Standard (RFC ...

... the Ras pathway. Ras is a small GTPase and constitutively active Ras is the most common oncogene in human... occur in the Ras gene it can be stuck in a constitutively active form, constantly activating pathways...cell growth and potentially leading to cancer. Constitutively active Ras is the most common oncogene in human...v-akt murine thymoma viral oncogene homolog 3 ALK Anaplastic lymphoma receptor tyrosine kinase ARHGAP35 Rho...MLST8 MTOR associated protein, LST8 homolog MTOR Mechanistic target of rapamycin NF1 Neurofibromin 1 NFE2L2... 1 RALGDS Ral guanine nucleotide dissociation stimulator RAPGEF RAPGEF1 RAPGEF2 Rap guanine nucleotide.... The RAS Initiative - at the National Cancer Institute (NCI) References Ras oncogenes and their downstream...