Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 643 results for: ato

Showing: 601 - 630 of 643 results

  1. CRISPR/Cas9 FAQs Answered!

    Type
    Blog Post
    ...Konermann, S., Trevino, A. E., Scott, D. A., Inoue, A., Matoba, S., Zhang, Y., & Zhang, F. (2013). Double nicking...

  3. Transfection for Recombinant Antibodies

    Type
    Protocol
    ...Harvest antibody Equipment Biosafety Cabinet 4 °C Refrigerator Micropipettes and tips Pipettor and pipettes...conical tubes Automated cell counter 37 °C, 5% CO 2 incubator with shaking platform set to 120 rpm 37 °C bead... mL vented flask.Incubate in a 37 °C, 5% CO 2 incubator on a shaking platform set to 120 rpm. Pro-Tip ...swirl 5–10 times to mix. Return the flask to the incubator. Section 3: BCD Feed and valproic acid supplementation...

  4. Centrifugation

    Type
    Protocol
    ... the two, use a conversion calculator or chart like the G Force calculator (Link opens in a new window...Introduction A centrifuge is a common piece of laboratory equipment used to separate different components...

  5. Immunocytochemistry

    Type
    Protocol
    ...water Microscope slide Anti-fade mounting medium Laboratory wipes 15 mL conical tubes 50 mL conical tubes...paraformaldehyde and follow your institution's laboratory safety guidelines for disposing of waste in the...remove the coverslip. Blot the coverslip with a laboratory wipe to remove excess liquid. Add 1 drop of anti-fade...

  6. Isolating a Monoclonal Cell Population by Limiting Dilution

    Type
    Protocol
    ...pipette 200–1000 µL single channel pipette CO 2 incubator Pipet controller Hazardous waste container Microscope...orange/yellow if using a standard phenol red pH indicator) because the buildup of waste products could be...difficult to find. Leave the cells undisturbed in an incubator for 7–14 days. After ~7 days, scan the plate for...

  7. CRISPR Library Amplification

    Type
    Protocol
    ...require modifications dictated by the originating laboratory for optimal results. If you obtained the pooled...limited. Equipment Table top centrifuge BioRad Electroporator (MicroPulser TM , Bio-Rad 1652100) Reagents...time for a total of eight electroporations): Electroporator Conditions: Bio-Rad Micropulser Ec1 0.1 cm ...

  9. Protocol - How to Streak a Plate

    Type
    Protocol
    ...loop Bunsen burner (or other small flame source) Incubator Marker Reagents LB agar plate (with appropriate...resistance and your initials. Labeling within a laboratory setting is important for organization, and it...

  10. Protocol - Over-Agar Antibiotic Plating

    Type
    Protocol
    ...spreading of antibiotic makes it easy for an investigator to conveniently plate and select transformed...spreading Bunsen burner (or other small flame source) Incubator Reagents 6 cm diameter LB/agar plates without ...

  11. Protocol - pLKO.1 – TRC Cloning Vector

    Type
    Protocol
    ...Addgene’s Mammalian RNAi Tools page. Several other laboratories have deposited pLKO derived vectors that may... temperature. g. Retrieve HEK-293T cells from incubator. The cells should be 50-80% confluent and in DMEM...should be decontaminated with at least 10% bleach. Laboratory materials that come in contact with viral particles...

  12. Water Bath Protocol

    Type
    Protocol
    ... lab! Introduction A water bath is a piece of laboratory equipment that helps bring your materials to .... Water baths can also be placed in walk-in refrigerators to achieve a temperature between 4°C and room...

  13. Video Library

    Type
    Protocol
    ... Protocols Video protocol guides for standard laboratory procedures. How-To Videos Screencapture walk-...Electrophoresis Gel electrophoresis is the standard laboratory procedure for separating DNA by size for visualization...

  15. Protocol - How to Ligate Plasmid DNA

    Type
    Protocol
    .... Use a (Link opens in a new window) ligation calculator to easily quantify how much vector and insert...vector end. (Link opens in a new window) Ligation calculators are easily found on the web. Just enter the concentration...

  16. Colony Formation Titering Assay

    Type
    Protocol
    ...1000 µL single channel pipette Ice bucket CO 2 incubator Pipet controller Hazardous waste container Reagents...Swirl gently to mix and place the dish in the incubator. Incubate for 48–72 h. Pro-Tip Different cells...

  17. Using a Light Microscope Protocol

    Type
    Protocol
    ...research and are found in many different types of laboratories. These tools allow you to observe specimens ... in the future. Conclusion Like any important laboratory instrument, you should be sure to take care of...

  18. Pipetting Protocol

    Type
    Protocol
    ...liquid (think: 0.1 µL to 1 mL). When working in a laboratory, properly dispensing liquid ensures the accuracy...Reagents Liquid for pipetting Background Information Anatomy of a Pipette This front view photo of a P1000 pipette...

  19. Promoters

    Type
    Guide
    ...by various DNA regulatory sequences including enhancers, boundary elements, insulators, and silencers....the RNA polymerase, an operator, a segment of DNA in which a repressor or activator can bind, and the structural...proximal promoter which contains many primary regulatory elements. The proximal promoter is found approximately...transcription factor binding sites, but mostly contains regulatory elements. Eukaryotic Promoters Eukaryotic Transcription... sequences. It is not unusual to have several regulatory elements such as enhancers several kilobases ...genes that are controlled by a single promoter and operator. Operons are common in prokayotes, specifically...its conformation, preventing its binding to the operator and thus allowing for transcription. The Lac operon...

  20. CRISPR Guide

    Type
    Guide
    ...effective gene activators when fused with dCas9. Recently, synthetic CRISPR-Cas gene activators have been ...zinc finger nucleases (ZFNs) or transcription-activator-like effector nucleases (TALENs) required scientists...fusing dCas9 to transcriptional repressors or activators and targeting promoter regions. You might sometimes...mice and human cells. The simplest dCas9-based activators and repressors consist of dCas9 fused directly...directly to a single transcriptional activator (e.g. VP64) or repressor (e.g. KRAB; Figure 9A). Other examples...co-expression of epitope-tagged dCas9 and antibody-activator effector proteins; long-term imaging of proteins...instead of a two-component system (Figure 9C) SAM activators - co-expression of dCas9-VP64 with a modified...

  21. Sequencing Primers

    Type
    Guide
    ...forward primer tdTomato-Fwd CTGTTCCTGTACGGCATGG 3' end of tdTomato, forward primer tdTomato-Rev TCTTTGATGACGGCCATGT...GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1 terminator, reverse primer 5'AOX1 GACTGGTTCCAATTGACAAGC ...TAGAAGGCACAGTCGAGG (Invitrogen) Bovine growth hormone terminator, reverse primer Bglob-intron-F CTGGTCATCATCCTGCCTTT... GTGGTTTGTCCAAACTCATC (Invitrogen) SV40 polyA terminator, reverse primer Ecdysone Forward CTCTGAATACTTTCAACAAGTTAC...hGH-PA-R CCAGCTTGGTTCCCAATAGA Human growth hormone terminator, reverse primer hrGFP-R TCCCCGAGTACCACTTCATC ...Reverse GAGTCACTTTAAAATTTGTATACAC (Invitrogen) ADH terminator, reverse primer pLTet-F ACTGAGCACATCAGCAGGAC ...forward primer T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator, reverse primer Tac promoter GAGCGGATAACAATTTCACACAGG...

  22. Lentiviral Vector Guide

    Type
    Guide
    ...lentiviral vectors that can be safely used in laboratory settings. These engineered lentiviral vectors...single strand of RNA contains packaging genes, regulatory genes, accessory genes, and the long-terminal...are necessary for lentiviral production in the laboratory, and many have been removed or mutated for increased...Wild-type lentiviruses additionally require the regulatory genes tat and rev , along with virus-specific... genome. To produce lentiviral vectors in the laboratory, the non-required components have been removed... — contains packaging genes gag and pol , and regulatory genes tat and rev ; separated into two plasmids...plasmid — contains entire viral genome (packaging, regulatory, and accessory genes), only envelope removed ...

  23. Optogenetics Guide

    Type
    Guide
    ...signals; e.g., calcium indicators In this overview, we will focus on the common actuators used in optogenetics...classified based on their functions into two groups: Actuators are genetically-encoded tools for light-activated...physiological pH and trafficks well to the membrane. Excitatory (Depolarizing) ChR Variants. The optogenetic ...experiment? Depending on your answer, you’d pick an excitatory or inhibitory opsin, respectively. Color of activation...domains bPAC Light-activated adenylyl cyclase from Beggiatoa sp. for light-induced cAMP modulation. Utilizes...plasmids rely on the engineered two-component regulatory system YF1/FixJ. YF1 is a synthetic, photosensitive...chromophore, and phosphorylates the transcriptional activator FixJ in the absence of blue light. 470 Fluorescent...

  24. Chemogenetics Guide

    Type
    Guide
    ... Experiment References Chemogenetic tools are actuators for specific cellular pathways, receptors, or ...of ion channels arePharmacologically Selective Actuator Modules (PSAMs, pronounced SAMs). PSAMs are engineered...Depending on your answer, you’d pick a chemogenetic activator or inhibitor, respectively. DREADDs or PSAMs or...delivery. Chemogenetic ligand. The chemogenetic actuator chosen and the context of the experiment will ...such as DCZ versus CNO. Delivery. Chemogenetic actuators are delivered in vivo through viral injection ...Selective Modulation of cAMP Production in Striatopallidal Neurons. Neuropsychopharmacol. 38:854–862. ...Deschloroclozapine, a potent and selective chemogenetic actuator enables rapid neuronal and behavioral modulations...

  25. DNA Quantification

    Type
    Protocol
    ... to protein (260/280) is generally used as an indicator of the purity of DNA samples. These days, many...

  26. Molecular Biology Reference

    Type
    Guide
    ...can be replicated easily and efficiently in a laboratory setting. Stable - Plasmids are stable long-term... contain a promoter sequence, a transcription terminator sequence, and the inserted gene. The promoter...RNA from the insert DNA via transcription. The terminator sequence on the newly synthesized RNA signals...design a effective primer. Sanger sequencing chromatogram Sanger sequencing is modeled after in vitro ...sequencing results are presented as a sequencing chromatogram which provides the color and intensity of each...

  27. Weighing Reagents Protocol

    Type
    Protocol
    ... reagents for a stock mixture is an essential laboratory technique, as imprecise measurements can affect...

  29. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...gamma-retroviral vectors that can be safely used in laboratory settings. These engineered gamma-retroviral vectors...increased safety when producing viral vectors in a laboratory setting. Figure 1: Wild-type gamma-retrovirus... Design. In Retroviruses . Cold Spring Harbor Laboratory Press. NIH Bookshelf De Ravin, S. S., Su, L.,...Woodchuck hepatitis virus post‐transcriptional regulatory element; stimulates the expression of transgenes...

  30. Fluorescence Titering Assay

    Type
    Protocol
    ...1000 µL single channel pipette Ice bucket CO 2 incubator Pipet controller Hazardous waste container Inverted...
Showing: 601 - 630 of 643 results