We narrowed to 541 results for: SHI
-
TypeProtocol...scrape and use spreader to scrape plates. Pro-Tip Pushing motion is better than pulling motion Take care ...
-
Optogenetics AAV Preps
TypeCollection....1-WPRE CamKII ChRmine (high-photocurrent, red-shifted) mScarlet Constitutive 8 Deisseroth 130995 pAAV-hSyn-ChRmine-mScarlet-Kv2.1...pAAV-hSyn-ChRmine-mScarlet-Kv2.1-WPRE Syn ChRmine (high-photocurrent, red-shifted) mScarlet Constitutive 8 Deisseroth 130998 pAAV-Ef1a-DIO-ChRmine-mScarlet-WPRE...pAAV-Ef1a-DIO-ChRmine-mScarlet-WPRE EF1a ChRmine (high-photocurrent, red-shifted) mScarlet Cre dependent 1, 5 Deisseroth 131004 ...6m-p2A-ChRmine-Kv2.1-WPRE Syn ChRmine (high-photocurrent, red-shifted) GCaMP6m Constitutive 8 Deisseroth 137158 pAAV-...pAAV-nEF-ChRmine-mScarlet nEF ChRmine (high-photocurrent, red-shifted) mScarlet Constitutive 8 Deisseroth 137159 pAAV-nEF-Con...Fon-ChRmine-oScarlet nEF ChRmine (high-photocurrent, red-shifted) oScarlet Cre and Flp dependent 8 Deisseroth 137160...Fon-ChRmine-oScarlet nEF ChRmine (high-photocurrent, red-shifted) oScarlet Flp dependent 8 Deisseroth 137161 pAAV-nEF-Con... -
Antibody Production
TypeCollection... testing, it may ship at room temperature. However, Addgene determines ideal shipping conditions for each...order, ensuring each item ships safely and most economically. Actual shipping conditions will be shown ...(Link opens in a new window) page. Storage and Shipping Stability Addgene does not recommend repeated ...20 °C. Each antibody catalog item is tested for shipping stability by incubating at 37 °C for 2 weeks, ... -
Addgene Packaged on Request: Scope of Service
TypeCollection...material received. Shipping While Addgene assists importation by including thorough shipping documents and ...Packaged on Request material is generally ready for shipment within 8 weeks after the approval of the MTA by...may not yet have been completed at the time of shipment. If any discrepancies are identified during this...request, within three years of the order being shipped, Addgene can provide the QC validation data performed... -
Fluorescent Protein Guide: Subcellular Localization
TypeCollection... EGFP Noboru Mizushima 38272 pMXs-IP GFP-WIPI-1 Autophagosome WIPI1 EGFP Noboru Mizushima 21074 ptfLC3... LC3 EGFP Tamotsu Yoshimori 21073 pEGFP-LC3 Autophagosome LC3 EGFP Tamotsu Yoshimori 24920 pEGFP-LC3 (...19031 pABCb10-GFP Mitochondria ABCb10 GFP Orian Shirihai 158003 pCMV-mGold-CAF1-C-10 Nucleus CAF-1 mGold...Golgi apparatus in vesicles to be packaged and shipped. Many of the proteins that enter the secretory ... -
Validated gRNA Sequences
TypeCollection...24967838 Mashimo Kit-2 R. norvegicus CTAACGTTCCAGCGCTCGTT 60970 cut S. pyogenes 24967838 Mashimo Kit-2 R...ATGACAGGAGTCTAACTCAC 60968 cut S. pyogenes 24967838 Mashimo ATF1 H. sapiens TAGGAATCAAACACTTTTATTGG 64690 tag...GTCAAGATGTCATCTTACGG 60971 cut S. pyogenes 24967838 Mashimo klp-12 C. elegans GATCCACAAGTTACAATTGG 46170 cut...TTTCCAGGATTATGTAATAG 60966 cut S. pyogenes 24967838 Mashimo Tyr (wild type) R. norvegicus TTTCCAGGATTACGTAATAG...TTTCCAGGATTACGTAATAG 60967 cut S. pyogenes 24967838 Mashimo unc-109(n499) C. elegans GGAACTCGTGTCAAAACAAC 59932 cut S... -
Zinc Finger Consortium: OPEN Reagents
TypeCollection...plasmid page and will be shipped as bacterial stabs. Add to Cart $ 350 USD + shipping Available to academics...and 3 individually packaged strains, which are shipped as bacterial stabs at room temperature. Individual...19798082 . Kit Contents The following items will be shipped as stabs at room temperature. ID Name 13421 pAC-Kan-alphaGal4... -
Fluorescent Protein Guide: Biosensors
TypeCollection...genetically encoded calcium sensor T-GECI Blue-shifted genetically encoded Ca(2+) indicator with enhanced...protein, QUEEN-37C. bioRxiv 2021.10.08.463131. Yasushi Okada ATP (extracellular) GRAB_ATP1.0/ATP1.0mut...Biol. 2021 Jun 29. pii: S2451-9456(21)00301-9. Takashi Tsuboi Glucose iGlucoSnFR-TS biosensor for intracellular...cell imaging. Sci Rep. 2020 Nov 11;10(1):19562. Takashi Tsuboi Maltose Single fluorescent protein biosensor...cell imaging. Sci Rep. 2020 Nov 11;10(1):19562. Takashi Tsuboi Sucrose FRET-based sensor to monitor sucrose.... Mol Cell. 2016 Nov 17;64(4):835-849. Noboru Mizushima Autophagy Autophagosome maturation reporter (pmRFP-LC3...fluorescent-tagged LC3. Autophagy. 2007;3(5):452-60. Tamotsu Yoshimori Autophagy Expresses pHluorin-mKate2-hLC3 (PK-hLC3... -
AAV Packaged on Request
TypeCollection...experiments. Shipping 2–7 days We will email you with tracking information as soon as your order ships. Shipping...approval, your institution’s approval of the MTA, and shipping, mean that the actual time from request to delivery... -
p53 Pathway
TypeCollection...for clarity and does not indicate a specific relationship. p53 Pathway Color is used for clarity and does... does not indicate a specific relationship. The content for this page was generated with the help of ....TP53 dependent G2 arrest mediator candidate Scotin Shisa family member 5 Sestrins SESN1 SESN2 SESN3 Sestrins... -
Neurodegeneration Plasmid Collection
TypeCollection...30 Frederic Mushinski 8418 pLTR PKC gamma PRKCG Spinocerebellar ataxia 29 Frederic Mushinski 8661 p4455...Flag CMV ALS Yossi Shiloh 32881 FLAG-Matr3 delRRM1 MATR3 Flag CMV ALS Yossi Shiloh 32882 FLAG-Matr3 delRRM2...Flag CMV ALS Yossi Shiloh 32883 FLAG-Matr3 delZnF1 MATR3 Flag CMV ALS Yossi Shiloh 32884 FLAG-Matr3 delZnF2...pBSSK+ PRPH T3 ALS Rita Shiang 98135 Peripherin/pAS2-1 PRPH ADH1 ALS Rita Shiang 98249 pHBS838 TDP43 RRM-GFP...delZnF2 MATR3 Flag CMV ALS Yossi Shiloh 34927 pTRE_tau-LacZ::tTA-H100Y MAPT LacZ TRE Parkinson's, FTD ... pMXs-IP HA-Parkin PRKN HA Parkinson's Noboru Mizushima 38938 PRKCG PRKCG His, TEV T7 Spinocerebellar ...James Trimmer 190693 pSN879 KIF5A mScarlet CMV ALS Shinsuke Niwa 190803 FUGW-APPwt-T2A-mCherry APP mCherry... -
Tetracycline Inducible Expression
TypeCollection...from the CAG promoter for Tet-Off tTA-Advanced Takeshi Imai 104109 pAAV-Syn1-tTA AAV Tet-Off vector, expressed...expressed tTA from the hSyn promoter tTA-Advanced Takeshi Imai Other Tet Applications Explore some other ...multicolor labeling for discriminating between neurons. Takeshi Imai 155257 Watermelon Pooled Library Lentiviral... -
Plasmids for Stem Cell Research
TypeCollection... years. All of this research led to Kazutoshi Takahashi and Shinya Yamanaka’s breakthrough development... -
Fluorescent Protein Guide: Empty Backbones
TypeCollection...Yellow Orange Red Far-Red Near-Infrared Long Stokes Shift Photoactivatable Photoconvertible Photoswitchable...Tetramer AmCyan1-N1 - Mammalian Expression MiCy (Midoriishi-Cyan) 472 495 25 6.6 Dimer MiCy-N1 - Mammalian... - Bacterial Expression Jump to Top Long Stokes Shift Protein Excitation (nm) Emission (nm) Brightness... -
AAV Viral Preps
TypeCollection...affordable, available in small volumes, and ready to ship. All viral vector preps are purified by density ...material page. Actual titers are reported with each shipment. If you can't find the prep you need, try Addgene's... -
Resolute Plasmid Collection
TypeCollection...Link opens in a new window) is a public-private partnership of 13 members from industry and academia financed...Feedback Please send your feedback to the Resolute Partnership using their RESOLUTE repository feedback form... -
mTOR Pathway
TypeCollection...for clarity and does not indicate a specific relationship. The content for this page was generated with... -
TALEN Guide
TypeCollection...assemble “multiple DNA fragments in an ordered fashion in a single reaction.” Using these plasmids, which...hope to continue to have a strong scientific partnership with both the labs that continue to hone these... -
Cre-lox system
TypeCollection...36915 pJJH1320 Cre Bacterial Heinisch 37404 Cre Shine Cre::2A::targeted FP construct CMV Mammalian Hughes...Addgene's Blog on FLEx Vectors . ∗ Note: Through a partnership with genOway, Addgene is able to distribute materials...cassette. Used in gene targeting. Mouse Targeting Shivdasani 18925 pJ241-FLEX FLEX switch empty backbone Sternson... -
Ras Pathway
TypeCollection...for clarity and does not indicate a specific relationship. The content and map for this page were generated...