Skip to main content
Addgene
Showing: 21 - 40 of 115 results
  1. CRISPR Plasmids - Yeast

    Type
    Collection
    ...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Base Edit Catalytically dead dCas9 fused to a...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted...Description Gene/Insert Promoter Selectable Marker PI Publication Activate Catalytically dead dCas9 fused to a ...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Interfere Catalytically dead dCas9, or dCas9 ...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Purify A catalytically inactive Cas9 (dCas9) ...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Empty gRNA Expression Vectors Select a gRNA expression...
  2. mTOR Pathway

    Type
    Collection
    ... the cell and regulates the switch from anabolic to catabolic processes. Active mTORC1 promotes protein...mTOR pathway. enhanced signaling of mTOR, a key metabolic regulator, correlates with poor prognosis in many...ammalian t arget o f r apamycin (mTOR) is a key metabolic regulator controlling cell growth and proliferation...energy-intensive processes. mTORC1 also blocks catabolic processes including autophagy and lysosome biogenesis...survival and proliferation. mTOR Pathway Plasmids Click on a name to find available plasmids for the gene...Sabatini . Return to top mTOR Pathway - Gene List Click on a name to find available plasmids for the gene...
  3. AAVED

    Type
    Collection
    ...control). The end result of the meeting will be a publicly shared practical guide for all scientists in the...useful to help improve this technology or its application? What are some current obstacles that researchers...prepare and compile resources for this meeting's publication, we are asking participants to share practical...antibodies and recommended dilutions, etc.), novel applications, or any other useful information. Experimental...have final approval before anything is released publicly, but please only share materials that you are ...materials that you have permission to share (e.g., publication's permission). Connie Cepko, Harvard Medical School...section for how to best help contribute to this publication. Citation information for openly shared communication...
  4. Plan Your Experiment

    Type
    Collection
    ...Manipulation Select Expression System Design gRNA Publications Get Started CRISPR is a powerful system that...may not be a perfect plasmid for your specific application, and in such cases, it may be necessary to customize...reagent to suit your needs. Genetic Manipulation Application Cas9 gRNA Additional Considerations Knockout ...method Expression System Components of System Application Mammalian expression vector Cas enzyme promoter...gene you target will depend on your specific application. For example: To activate or repress a target...region is removed from the mRNA due to alternative splicing. Exons near the N-terminus are targeted since ...validate your edit will depend upon your specific application. However, there are several common ways to verify...
  5. CRISPR Plasmids - Plants

    Type
    Collection
    ...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled... ID Plasmid Gene/Insert Selectable Marker PI Publication Base Edit Catalytically dead dCas9 fused to a...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Prime Edit Cas9 H840A nickase fused to a reverse...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Activate Catalytically dead dCas9 fused to a ...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Interfere Catalytically dead dCas9, or dCas9 ...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Empty gRNA Expression Vectors Select a gRNA expression...
  6. Synthetic Biology - Metabolism

    Type
    Collection
    ...headings. Click on the publication link to view all plasmids available from the article. Click on the PI...Synthetic Biology plasmids for metabolic enzymes and pathways. Plasmid...collection of synthetic biology plasmids related to metabolic pathways and components. Examples Include: Biofuels... Plasmid Gene/Insert Vector Type Promoter PI Publication Back to Top Do you have suggestions for other...
  7. Plasmids for Stem Cell Research

    Type
    Collection
    ...Blood Cells. Stem Cells. 2012 Nov 29. Yamanaka Replicating EBNA1 episome Human Non-integrating EBNA1-mediated... Nat Methods. 2011 May;8(5):409-12. Yamanaka Replicating EBNA1 episome Human Non-integrating polycistronic... S A. 2014 Jul 22;111(29):10678-83. Capecchi Replicating EBNA1 episome Human Fluorescent-tagged EBNA1-...Stem Cell Res Ther. 2017 Jun 5;8(1):132. Zovein Replicating EBNA1 episome Human Non-integrating EBNA1-mediated...RNA Human Non-integrating, polycistronic, self-replicating VEE RNA species expressing human Oct4, Klf4, ...generation of human iPSCs by a synthetic self-replicative RNA. Cell Stem Cell. 2013 Aug 1;13(2):246-54....Science. 2008 Nov 7;322(5903):949-53. Yamanaka Replicating EBNA1 episome Mouse Non-integrating EBNA1-mediated...
  8. CRISPR Plasmids - Single-Strand Break (Nick)

    Type
    Collection
    ...Marker PI Publication Bacteria ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Drosophila...Marker PI Publication Plant ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Yeast ID ...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...Description Gene/Insert Promoter Selectable Marker PI Publication Do you have suggestions for other plasmids that...
  9. All Antibodies

    Type
    Collection
    ...antibodies. These monoclonal antibodies undergo application-specific validation and quality control by Addgene...antigen. Addgene supplies a list of recommended applications based on our in-house testing and data provided...with full experimental details in the Antibody Applications section of our product pages. We also include... an antibody’s use is not recommended for an application or species. We currently assess western blot,...scientists to further develop and refine these application lists. The plasmids we use to produce antibodies...Source Species Isotype Reactivity Recommended Applications PI Return to Top Do you have suggestions for...
  10. CRISPR Plasmids - gRNAs

    Type
    Collection
    ...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...using any of these gRNA plasmids and review the publication associated with each plasmid for more information...upstream of a 5' NGG 3' PAM sequence. Which CRISPR application is this gRNA sequence compatible with? CRISPR...gRNAs you'd like to add to the Addgene collection? Click here to start the deposit process and have your ...CRISPR nuclease and function. Please see the publication or plasmid information page, or contact the depositing...plasmids. ID Plasmid Gene/Insert Vector Type PI Publication Do you have suggestions for other plasmids that...
  11. Zhang Lab's CRISPR Frequently Asked Questions

    Type
    Collection
    ...possible to find both single-allelic and bi-allelic cells. Single-allelic cells usually make up the majority...extensive homology of the protospacer followed by PAM. Click here for a target selection tool that should be ...plate. A good reference is this paper in Cell . Click here for a 2013 paper discussing conversion tract...a genotyping assay (such as Sanger sequencing). Click here for a useful reference. I have used 200ng to...very robust in this case for EMX1. Since the publication of our paper, we have two new optimized primers...
  12. Validated gRNA Sequences

    Type
    Collection
    ...upstream of a 5' NGG 3' PAM sequence). Which CRISPR application is this gRNA sequence compatible with? CRISPR...Resources page have been used to indicate the Cas9 application the gRNA was designed to accomplish. Validated...Gene Target Species Target Sequence Plasmid ID Application Cas9 Species PubMed ID Depositor OCT4 H. sapiens...cut S. pyogenes 23287722 Church actII-orf4 S. coelicolor ATTACCAGGGACCGGAGTTC 62552 cut S. pyogenes 25739462...musculus 64071 cut S. pyogenes 25337876 Ventura Amplicon, JAK2 H. sapiens GAGGCATATTCTTCTCCTGG 70660 cut...GCGCTTACACTTTAGGAGACACTC 61080 purify S. pyogenes 25051498 Fujii JAK2 amplicon H. sapiens GGTTTAATGGAAGAGAAGGG 70679 cut S. pyogenes... 70018 cut S. pyogenes 26541286 Voytas BCR/ABL amplicon H. sapiens GGCTCCCTTCAAGTGGGATG 70658 cut S. pyogenes...
  13. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...library page. Find Pooled Libraries of Interest Click on different properties to create a custom filtered...Activation Human Zhang 3rd 10 96,458 Human CRISPR Metabolic Gene Knockout Library 110066 Knockout Human Sabatini...Knockout Human Olzmann 3rd ~10 13,920 Human lncRNA Splicing-targeting CRISPR Library 119977 Knockout Human... Mouse Birsoy 3rd 7–10 2,105 630 Mouse CRISPR Metabolic Gene Knockout Library 160129 Knockout Mouse Birsoy...Knockout Mouse X.S. Liu 3rd 5 5 10 49,252 Human Metabolic Gene CRISPRa sgRNA Library 187080 Activation Human... Human Birsoy 3rd Varies 32,460 Mouse Metabolic Gene CRISPRa sgRNA Library 187081 Activation Mouse Birsoy...
  14. Brain Initiative Collection

    Type
    Collection
    ... the human brain through the development and application of innovative tools enabling large-scale real-time...or when BRAIN Initiative grants are noted in publications associated with Addgene materials. Plasmids ... enriched expression of GCaMP6s in axons with cytosolic expression of mKate2 Lin Tian 112005-AAV5 pAAV-hSynapsin1... enriched expression of GCaMP6s in axons with cytosolic expression of mRuby3 Lin Tian 112005-AAV9 pAAV-hSynapsin1... enriched expression of GCaMP6s in axons with cytosolic expression of mRuby3 Lin Tian 112006-AAV9 pAAV-hSynapsin1.... Useful for nuclear isolation and scRNA-seq applications. Jonathan Ting 163909-AAV9 pAAV_hSynapsin_psychLight2...antibodies are produced in-house and undergo application-specific validation and quality control by Addgene...
  15. Synthetic Biology - Browse Plasmids

    Type
    Collection
    ...headings. Click on the publication link to view all plasmids available from the article. Click on the PI...Addgene plasmids for use in synthetic biology applications, or from synthetic biology labs. Plasmid...Plasmid Description Gene/Insert Vector Type PI Publication...
  16. CRISPR Plasmids - Repress Gene Expression

    Type
    Collection
    ...Selectable Marker PI Publication Bacteria ID Plasmid Gene/Insert Promoter PI Publication Plant ID Plasmid ...Marker PI Publication Yeast ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Do you have...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...
  17. CRISPR Plasmids - Cascade-Cas3

    Type
    Collection
    ...Insert Promoter PI Publication Bacteria ID Plasmid Gene/Insert Promoter PI Publication Plant ID Plasmid ...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...non-targeted strand, Cas3 starts unraveling DNA using its helicase properties, cleaving the targeted strand non-specifically...Plasmid Gene/Insert Promoter PI Publication Last reviewed on: January 30, 2025 Do you have suggestions for other...
  18. CRISPR Plasmids - Drosophila

    Type
    Collection
    ...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...than NHEJ. ID Plasmid Gene/Insert Promoter PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted...repair (HDR). ID Plasmid Gene/Insert Promoter PI Publication Prime Edit Cas9 H840A nickase fused to a reverse...template. ID Plasmid Gene/Insert Promoter PI Publication Activate Catalytically dead dCas9 fused to a ...specific locus. ID Plasmid Gene/Insert Promoter PI Publication Empty gRNA Expression Vectors Select a gRNA expression...
  19. CRISPR Plasmids - Prime Edit

    Type
    Collection
    ...Marker PI Publication Bacteria ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Plant ID...Marker PI Publication Drosophila ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Empty Prime...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...
  20. Microbiology Resources

    Type
    Collection
    ...distributes cannot be used to reconstitute self-replicating microbes or recreate the diseases they cause....our Search page to look for specific genes or applications that are not listed here. Addgene Microbiology...Enterococcus sp. Geobacillus sp. Haemophilus influenzae Helicobacter pylori Listeria monocytogenes Mycobacterium ...Densmore Lab EcoFlex MoClo : Modular cloning for applications like recombinant protein purification and cell-free...fluorescent protein plasmid collection is organized by application and by color. External Resources European Saccharomyces...
Showing: 21 - 40 of 115 results