We narrowed to 37 results for: atic
-
TypeCollection...of the C. elegans hermaphrodite consists of 959 somatic cells, which makes them attractive for imaging ...
-
CRISPR Plasmids - Bacteria
TypeCollection...cleaved the target RNA sequence, they adopt an enzymatically active state and can bind and cleave additional... -
TALEN Guide
TypeCollection...Pubmed PMID: 21493687 . Targeted gene disruption in somatic zebrafish cells using engineered TALENs. Sander... -
Zebrafish Plasmid Collection
TypeCollection...multicellular systems typically relies on genetic markers, somatic mutations, or labeling with fluorescent proteins... -
CRISPR Plasmids - Mammalian Expression
TypeCollection...gRNA to recruit a cytidine deaminase and induce somatic hypermutation in a 100 bp window. This technique... -
Ras Pathway
TypeCollection...survival, adhesion, growth, and differentiation. Schematic of Ras signaling cascade that starts at the plasma... -
TALEN Plasmids and Kits
TypeCollection...Assembly via serial ligation. Validated in zebrafish somatic cells. Keith Joung Zhang Lab TALE Toolbox PCR/Golden... -
COVID-19 Resources
TypeCollection...optimize the method termed Specific High Sensitivity Enzymatic Reporter UnLOCKING (SHERLOCK and SHERLOCKv2). ... -
CRISPR References and Information
TypeCollection...pAC149 ; Gateway destination: pAC90 PDF, 1.1 MB Katic Nematode: Cas9 and gRNA use Cas9 (pIK86) ; gRNA ... -
Luciferase Plasmid Collection
TypeCollection...variety of organisms, ranging from bacteria to aquatic animals to insects. Luciferase catalyzes the oxidation... -
Genetic Code Expansion
TypeCollection...Peter Schultz 49086 pDULE-ABK PylRS M. barkeri aliphatic diazirine amino acid Bacerial, Mammalian TAG Peter... -
Validated gRNA Sequences
TypeCollection...GCTACCATAGGCACCACGAG 65630 cut S. pyogenes 26044730 Katic dpy-10 C. elegans GCTACCATAGGCACCACGAG 59933 cut... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...Boxem pIK198 65629 Worm Gibson none S. pyogenes Katic pHKMC1: Empty sgRNA for Cloning 67720 Worm NotI/... -
Antibody Guide
TypeCollection...Fab fragments - Fab fragments are created by enzymatically cleaving the variable regions of an antibody... -
Cre-lox system
TypeCollection... the genetic material will be rearranged. The schematic below shows the three types of rearrangements:... -
Trimmer Lab NeuroMab Collection
TypeCollection... al., 2002 (Link opens in a new window) . The schematic to the right shows the separate elements of the... -
Immunology Research Plasmids and Resources
TypeCollection... pro-platelet basic protein-like 2 SPBPBP PPY pancreatic polypeptide PNP PRL prolactin - PRLH prolactin...