We narrowed to 115 results for: lic
-
TypeCollection...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled... ID Plasmid Gene/Insert Selectable Marker PI Publication Base Edit Catalytically dead dCas9 fused to a...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Prime Edit Cas9 H840A nickase fused to a reverse...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Activate Catalytically dead dCas9 fused to a ...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Interfere Catalytically dead dCas9, or dCas9 ...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Empty gRNA Expression Vectors Select a gRNA expression...
-
Synthetic Biology - Metabolism
TypeCollection...headings. Click on the publication link to view all plasmids available from the article. Click on the PI...Synthetic Biology plasmids for metabolic enzymes and pathways. Plasmid...collection of synthetic biology plasmids related to metabolic pathways and components. Examples Include: Biofuels... Plasmid Gene/Insert Vector Type Promoter PI Publication Back to Top Do you have suggestions for other... -
Plasmids for Stem Cell Research
TypeCollection...Blood Cells. Stem Cells. 2012 Nov 29. Yamanaka Replicating EBNA1 episome Human Non-integrating EBNA1-mediated... Nat Methods. 2011 May;8(5):409-12. Yamanaka Replicating EBNA1 episome Human Non-integrating polycistronic... S A. 2014 Jul 22;111(29):10678-83. Capecchi Replicating EBNA1 episome Human Fluorescent-tagged EBNA1-...Stem Cell Res Ther. 2017 Jun 5;8(1):132. Zovein Replicating EBNA1 episome Human Non-integrating EBNA1-mediated...RNA Human Non-integrating, polycistronic, self-replicating VEE RNA species expressing human Oct4, Klf4, ...generation of human iPSCs by a synthetic self-replicative RNA. Cell Stem Cell. 2013 Aug 1;13(2):246-54....Science. 2008 Nov 7;322(5903):949-53. Yamanaka Replicating EBNA1 episome Mouse Non-integrating EBNA1-mediated... -
CRISPR Plasmids - Activate Gene Expression
TypeCollection...Marker PI Publication Return to top Bacteria ID Plasmid Gene/Insert Promoter PI Publication Return to ...Marker PI Publication Return to top C. elegans ID Plasmid Gene/Insert Promoter PI Publication Return to...Drosophila ID Plasmid Gene/Insert Promoter PI Publication Return to top Plant ID Plasmid Gene/Insert Promoter...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Return to top CRISPR Resources Addgene has a ... -
All Antibodies
TypeCollection...antibodies. These monoclonal antibodies undergo application-specific validation and quality control by Addgene...antigen. Addgene supplies a list of recommended applications based on our in-house testing and data provided...with full experimental details in the Antibody Applications section of our product pages. We also include... an antibody’s use is not recommended for an application or species. We currently assess western blot,...scientists to further develop and refine these application lists. The plasmids we use to produce antibodies...Source Species Isotype Reactivity Recommended Applications PI Return to Top Do you have suggestions for... -
CRISPR Plasmids - gRNAs
TypeCollection...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...using any of these gRNA plasmids and review the publication associated with each plasmid for more information...upstream of a 5' NGG 3' PAM sequence. Which CRISPR application is this gRNA sequence compatible with? CRISPR...gRNAs you'd like to add to the Addgene collection? Click here to start the deposit process and have your ...CRISPR nuclease and function. Please see the publication or plasmid information page, or contact the depositing...plasmids. ID Plasmid Gene/Insert Vector Type PI Publication Do you have suggestions for other plasmids that... -
CRISPR Plasmids - Base Edit
TypeCollection...and are thus well suited to directed evolution applications. Examples of these base editing systems include...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Return to top Bacteria ID Plasmid Gene/Insert...Insert Promoter Selectable Marker PI Publication Return to top Plant ID Plasmid Gene/Insert Promoter Selectable...Selectable Marker PI Publication Return to top Yeast ID Plasmid Gene/Insert Promoter Selectable Marker PI...PI Publication Return to top Zebrafish ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication... -
Validated gRNA Sequences
TypeCollection...upstream of a 5' NGG 3' PAM sequence). Which CRISPR application is this gRNA sequence compatible with? CRISPR...Resources page have been used to indicate the Cas9 application the gRNA was designed to accomplish. Validated...Gene Target Species Target Sequence Plasmid ID Application Cas9 Species PubMed ID Depositor OCT4 H. sapiens...cut S. pyogenes 23287722 Church actII-orf4 S. coelicolor ATTACCAGGGACCGGAGTTC 62552 cut S. pyogenes 25739462...musculus 64071 cut S. pyogenes 25337876 Ventura Amplicon, JAK2 H. sapiens GAGGCATATTCTTCTCCTGG 70660 cut...GCGCTTACACTTTAGGAGACACTC 61080 purify S. pyogenes 25051498 Fujii JAK2 amplicon H. sapiens GGTTTAATGGAAGAGAAGGG 70679 cut S. pyogenes... 70018 cut S. pyogenes 26541286 Voytas BCR/ABL amplicon H. sapiens GGCTCCCTTCAAGTGGGATG 70658 cut S. pyogenes... -
Brain Initiative Collection
TypeCollection... the human brain through the development and application of innovative tools enabling large-scale real-time...or when BRAIN Initiative grants are noted in publications associated with Addgene materials. Plasmids ... enriched expression of GCaMP6s in axons with cytosolic expression of mKate2 Lin Tian 112005-AAV5 pAAV-hSynapsin1... enriched expression of GCaMP6s in axons with cytosolic expression of mRuby3 Lin Tian 112005-AAV9 pAAV-hSynapsin1... enriched expression of GCaMP6s in axons with cytosolic expression of mRuby3 Lin Tian 112006-AAV9 pAAV-hSynapsin1.... Useful for nuclear isolation and scRNA-seq applications. Jonathan Ting 163909-AAV9 pAAV_hSynapsin_psychLight2...antibodies are produced in-house and undergo application-specific validation and quality control by Addgene... -
Tetracycline Inducible Expression
TypeCollection...tTA-Advanced Takeshi Imai Other Tet Applications Explore some other popular applications of tetracycline systems ... VP16 transcriptional activation domain). For simplicity, other promoter elements are not shown. Tetracycline...for comparison of Tet-On systems in different applications. Use of Tetracycline or a Derivative Doxycycline...vectors for transactivators, and vectors for other applications, or search our collection for all dox-regulated...interaction mapping via Cas13-based APEX targeting Alice Ting 85040 pK170.AAV-TRE-Cre-WPRE (Supernova) AAV... of Cre recombinase. Madeline Lancaster 198752 DiLiCre 2.0 Dox-inducible expression of a light-activated... -
Synthetic Biology - Browse Plasmids
TypeCollection...headings. Click on the publication link to view all plasmids available from the article. Click on the PI...Addgene plasmids for use in synthetic biology applications, or from synthetic biology labs. Plasmid...Plasmid Description Gene/Insert Vector Type PI Publication... -
CRISPR Plasmids - Single-Strand Break (Nick)
TypeCollection...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Return to top Bacteria ID Plasmid Gene/Insert...Insert Promoter Selectable Marker PI Publication Return to top Drosophila ID Plasmid Gene/Insert Promoter ...Promoter Selectable Marker PI Publication Return to top Plant ID Plasmid Gene/Insert Promoter Selectable Marker...Marker PI Publication Return to top Yeast ID Plasmid Description Gene/Insert Promoter Selectable Marker ...Marker PI Publication Return to top CRISPR Resources Addgene has a large selection of CRISPR plasmids and resources... -
CRISPR Plasmids - Drosophila
TypeCollection...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...than NHEJ. ID Plasmid Gene/Insert Promoter PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted...repair (HDR). ID Plasmid Gene/Insert Promoter PI Publication Prime Edit Cas9 H840A nickase fused to a reverse...template. ID Plasmid Gene/Insert Promoter PI Publication Activate Catalytically dead dCas9 fused to a ...specific locus. ID Plasmid Gene/Insert Promoter PI Publication Empty gRNA Expression Vectors Select a gRNA expression... -
Microbiology Resources
TypeCollection...distributes cannot be used to reconstitute self-replicating microbes or recreate the diseases they cause....our Search page to look for specific genes or applications that are not listed here. Addgene Microbiology...Enterococcus sp. Geobacillus sp. Haemophilus influenzae Helicobacter pylori Listeria monocytogenes Mycobacterium ...Densmore Lab EcoFlex MoClo : Modular cloning for applications like recombinant protein purification and cell-free...fluorescent protein plasmid collection is organized by application and by color. External Resources European Saccharomyces... -
Adeno-associated virus (AAV) Plasmids
TypeCollection...plasmid (or Rep/Cap plasmid) containing the AAV replication (Rep) and capsid (Cap) genes necessary for the...the AAV genome, but are required for AAV viral replication. This collection provides a curated selection...production suitable for a variety of serotypes and applications. Read our AAV vector guide for more information...plasmids, or RepCap plasmids, encode the AAV replication and capsid proteins necessary for AAV vector ...such as adenovirus or herpes simplex virus, to replicate in the host cell and complete the lytic cycle.... -
Synthetic Biology - Algal
TypeCollection...headings. Click on the publication link to view all plasmids available from the article. Click on the PI...Plasmid Description Gene/Insert Vector Type PI Publication Do you have suggestions for other plasmids that... -
Synthetic Biology - Bacterial
TypeCollection...headings. Click on the publication link to view all plasmids available from the article. Click on the PI...Plasmid Description Gene/Insert Vector Type PI Publication Do you have suggestions for other plasmids that... -
Synthetic Biology - Fungal
TypeCollection...headings. Click on the publication link to view all plasmids available from the article. Click on the PI...Plasmid Description Gene/Insert Vector Type PI Publication Do you have suggestions for other plasmids that... -
Synthetic Biology - Mammalian
TypeCollection...headings. Click on the publication link to view all plasmids available from the article. Click on the PI...Plasmid Description Gene/Insert Vector Type PI Publication Do you have suggestions for other plasmids that... -
Synthetic Biology - Plant
TypeCollection...headings. Click on the publication link to view all plasmids available from the article. Click on the PI...Plasmid Description Gene/Insert Vector Type PI Publication Do you have suggestions for other plasmids that...