We narrowed to 416 results for: Superfolder GFP
-
Plasmid#231548PurposeMammalian expression of human beta actin fused to C-terminally truncated monomeric superfolder GFP, for actin filament organization measurements using fluorescence polarization microscopyDepositorAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pCT5-bac2.0
Plasmid#119872PurposeCumate-inducible expression of sfGFP gene in Bacillus subtilis, B. megaterium, and Escherichia coliDepositorInsertsCymR
sfGFP
UseSynthetic BiologyExpressionBacterialPromoterPveg promoter with CuO sequence and PxylR promoterAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCT5-bac1.8
Plasmid#119871PurposeConstitutive expression of sfGFP gene in Bacillus subtilis, B. megaterium, and Escherichia coliDepositorInsertsCymR'
sfGFP
UseSynthetic BiologyExpressionBacterialMutationSNP in 592 bpPromoterPserA promoter and Pveg promoter with CuO sequenceAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pS2513·PHP
Plasmid#122590PurposeConstitutive expressed pHiorine2 for pH quan. in gram-negative cellsDepositorInsertphIorine2
UseSynthetic BiologyExpressionBacterialPromoterPem7Available SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
GTU-g
Plasmid#81094PurposeGene Tagging vector URA/GFP - Plasmid for superfolder GFP (sfGFP) labeling of endogenous proteins with a URA selection marker, originating from pSIVu (ID:81089)DepositorInsertsfGFP
UseCre/LoxTagssfGFPExpressionYeastAvailable SinceNov. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pnEA-vH_His-TEV-SEPT2 NCmut-msfGFP_SEPT6
Plasmid#180312Purposebacterial co-expression of human SEPT2 NCmut fused to monomeric superfolder GFP and of human SEPT6DepositorTagsHis6-TEV and msfGFPExpressionBacterialMutationSEPT2 F20D, V27DAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKD068
Plasmid#136471PurposeSSB-GFP IDL fusion expression plasmidDepositorInsertSSB-GFP (ssb E. coli)
Tagssuperfolder GFPExpressionBacterialMutationsuperfolder GFP inserted between Phe148 and Ser149PromoterT7 promoterAvailable SinceApril 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKD072
Plasmid#136472PurposeSSB-C-term-GFP fusion expression plasmidDepositorInsertSSB-C-term-GFP (ssb E. coli)
Tagssuperfolder GFPExpressionBacterialMutationsuperfolder GFP attached to C-terminus at Phe 178PromoterT7 promoterAvailable SinceApril 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
POLArIS_NbVim-cp10GFP
Plasmid#171020PurposeExpresses NbVim-cp10GFP#2 in mammalian cellsDepositorInsertanti-vimentin-nanobody VB6 (NbVim) tagged with circularly permutated superfolderGFP(cp10GFP)
Tagscp10GFPExpressionBacterial and MammalianPromoterCMV promoterAvailable SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCS2+MCS-P2A-sfGFP
Plasmid#74668PurposePlasmid for expression of wild-type or mutant cDNA fragments (mutation reporter) or complete cDNAs in frame with superfolderGFP.DepositorInsertsfGFP
ExpressionMammalianAvailable SinceMay 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJK2020
Plasmid#171932Purposeexpress MS2 coat protein (MCP) fused to superfolder GFP and histone subunit H2B fused to mCherry in an operonDepositorInsertPmex-5::MS2 Coat Protein::linker::sfGFP::tbb-2 3'UTR::gpd-2 intergenic sequence::H2B::mCherry::unc-54 3'UTR
Tagssuperfolder GFP, mCherryExpressionWormPromoter-Available SinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHR-CD5-NbHA-sfGFP
Plasmid#242818PurposeStable expression of NbHA-superfolderGFP for secretion of fusion protein into the extracellular mediumDepositorInsertNbHA
UseLentiviralTagssfGFPExpressionMammalianPromoterSFFVAvailable SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGWKS12
Plasmid#139419PurposeFluoroescent marker for use in Cryptococcus neoformans. Contains a codon optimised Superfolder GFP marker.DepositorInsertSuperfolder GFP
ExpressionYeastPromoterTEF1Available SinceMay 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFP35
Plasmid#247210PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (DF30ppr) from a T7 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with F30 scaffold)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterT7Available SinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP59
Plasmid#247215PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available SinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP60
Plasmid#247216PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (DF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with F30 scaffold)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available SinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP34
Plasmid#247209PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from a T7 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterT7Available SinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP34∆RBS
Plasmid#247213PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from a T7 promoter but lacks a ribosomal binding site. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterT7Available SinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP35∆RBS
Plasmid#247214PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (DF30ppr) from a T7 promoter but lacks a ribosomal binding site. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with F30 scaffold)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterT7Available SinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
TfR-SpyCatcher003(K31TAG)-sfGFP-MycTag-CTag
Plasmid#210021PurposeExpression of transferrin receptor transmembrane domain and photocaged SpyCatcher003(K31HCK)-sfGFP on mammalian cell surface.DepositorInsertTransferrin receptor transmembrane domain-SpyCatcher003(K31TAG)-superfolderGFP-MycTag-CTag (TFRC Synthetic, Human)
TagsMycTag, CTagExpressionMammalianMutationTransferrin receptor transmembrane domain with Y2…PromoterCMV promoterAvailable SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGustiv
Plasmid#240335PurposeExpresses BK polyomavirus genotype IV capsid protein VP1 in yeast. Expression of VP1 (and a GFP reporter) is induced by maltose.DepositorInsertsBKV-IV VP1
Superfold GFP
Formaldehyde dehydrogenase 1
ExpressionYeastPromoterFDH1, MAL31, and MAL32Available SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
C90m
Plasmid#120998PurposeMoClo golden gate assembly CD part for NahR-sfGFP fusion (Adam Meyer improved NahR (C75m) fused to superfolder GFP (C3m)). Please see Supplemental Documents for annotated Genbank file.DepositorInsertNahRsfGFP fusion
UseSynthetic BiologyAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRSET a sfGCaMP6s
Plasmid#100022PurposeBacterial expression of fluorescent reporter for calcium signaling, based off of GCaMP6s. cpEGFP replaced with a superfolder cpGFP variant.DepositorInsertsfGCaMP6s
Tags6x HIS tag and Xpress_EK tagExpressionBacterialMutationcpEGFP replaced with superfolder cpGFPPromoterT7Available SinceOct. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRSET a sfGCaMP6s-T78H
Plasmid#100023PurposeBacterial expression of fluorescent reporter for calcium signaling, based off of GCaMP6s. cpEGFP replaced with a superfolder cpGFP variant containing T78H mutationDepositorInsertsfGCaMP6s-T78H
Tags6x HIS tag and Xpress_EK tagExpressionBacterialMutationcpEGFP replaced with superfolder cpGFP and T78H m…PromoterT7Available SinceOct. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRSET a sfMatryoshCaMP6s
Plasmid#100020PurposeBacterial expression of fluorescent reporter for calcium signaling, based off of GCaMP6s. Contains a stable reference Large Stokes Shift (LSS) mOrange nested within the reporting superfolder cpGFP.DepositorInsertsfMatryoshCaMP6s
Tags6x HIS tag and Xpress_EK tagExpressionBacterialMutationcpEGFP replaced with superfolder cpGFPPromoterT7Available SinceOct. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBAD YuzuFP
Plasmid#240149PurposeExpresses YuzuFP in E. coli using arabinose inductionDepositorInsertYuzuFP
Tags6xHis tagExpressionBacterialMutationH148SPromoterArabinoseAvailable SinceJune 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
CytERM-mTurquoise2
Plasmid#98833PurposeIn vivo visualization of the ER (can be used for colocalization studies and the OSER assay)DepositorInsertCytERM
TagsmTurquoise2ExpressionMammalianPromoterCMVAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRSET a sfMatryoshCaMP6s-T78H
Plasmid#100021PurposeBacterial expression of fluorescent reporter for calcium signaling, based off of GCaMP6s. Contains a stable reference LSSmOrange nested within the reporting superfolder cpGFP-T78HDepositorInsertsfMatryoshCaMP6s
Tags6x HIS tag and Xpress_EK tagExpressionBacterialMutationcpEGFP replaced with superfolder cpGFP and T78H m…PromoterT7Available SinceOct. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSABAD505
Plasmid#45615DepositorInsertGFPN-NpuDnaE_intein-GFP_C
TagsGFP_C and GFP_NExpressionBacterialMutationstemmer GFP with superfolder mutations S30R and Y…PromoterpBADAvailable SinceSept. 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSARSF505
Plasmid#46832DepositorInsertGFPN-NpuDnaE_intein-GFP_C
TagsGFP_C and H6-GFP_NExpressionBacterialMutationstemmer GFP with superfolder mutations S30R and Y…PromoterT7Available SinceSept. 13, 2013AvailabilityAcademic Institutions and Nonprofits only