We narrowed to 15,154 results for: GRN

#138186

3rd generation lentiviral gRNA plasmid targeting human KAT2A

Wen Xue

Kwan et al Hepatology. 2019 Jun 12. doi: 10.1002/he

March 18, 2020

Academic Institutions and Nonprofits only

#138185

3rd generation lentiviral gRNA plasmid targeting human KAT2A

Wen Xue

Kwan et al Hepatology. 2019 Jun 12. doi: 10.1002/he

March 18, 2020

Academic Institutions and Nonprofits only

#138184

3rd generation lentiviral gRNA plasmid targeting human TRRAP

Wen Xue

Kwan et al Hepatology. 2019 Jun 12. doi: 10.1002/he

March 18, 2020

Academic Institutions and Nonprofits only

#84780

Expresses major satellite-specific sgRNA.

Heinrich Leonhardt

Schmidtmann et al Nucleus. 2016 Sep 27:0.

July 13, 2019

Academic Institutions and Nonprofits only

#113130

Expresses gRNA targeting the IL1RN promoter (SpyCas9 scaffold)

Dominik Niopek

Bubeck et al Nat Methods. 2018 Oct 30. pii: 10.1038/s

March 15, 2019

Academic Institutions and Nonprofits only

#107330

U6 driven SaCas9 sgRNA expression for VEGFA site 3

Scot Wolfe

Bolukbasi et al Nat Commun. 2018 Nov 19;9(1):4856. doi:

Nov. 15, 2018

Academic Institutions and Nonprofits only

#113132

Expresses gRNA targeting the IL1RN promoter (SpyCas9 scaffold)

Dominik Niopek

Bubeck et al Nat Methods. 2018 Oct 30. pii: 10.1038/s

Nov. 1, 2018

Academic Institutions and Nonprofits only

#100557

Expresses MYC sgRNA5. Target sequence GAGAGGCAGAGGGAGCGAGC

Dustin Maly

Rose et al Nat Methods. 2017 Jul 24. doi: 10.1038/n

Sept. 27, 2017

Academic Institutions and Nonprofits only

#89957

Contains arabinose-induced lambda Red and a tet-inducible gRNA targeting rssA.

Michael Lynch

Moreb et al ACS Synth Biol. 2017 Oct 2. doi: 10.1021

June 19, 2017

Academic Institutions and Nonprofits only

#89953

Contains arabinose-induced lambda Red and a tet-inducible gRNA targeting rpsL.

Michael Lynch

Moreb et al ACS Synth Biol. 2017 Oct 2. doi: 10.1021

June 19, 2017

Academic Institutions and Nonprofits only

#89951

Contains arabinose-induced lambda Red and a tet-inducible gRNA targeting malG.

Michael Lynch

Moreb et al ACS Synth Biol. 2017 Oct 2. doi: 10.1021

June 19, 2017

Academic Institutions and Nonprofits only

#87396

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87401

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87405

p426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#68807

specific sgRNA against mouse Dicer1 gene cloned in the pX330 backbone (Addgene Number 42230). Generation of Dicer1 knockout mESCs.

Constance Ciaudo

Bodak et al FEBS Open Bio. 2017 Jan 11;7(2):204-220.

Feb. 13, 2017

Academic Institutions and Nonprofits only

#68808

specific sgRNA against mouse Dicer1 gene cloned in the pX330 backbone (Addgene Number 42230). Generation of

Constance Ciaudo

Bodak et al FEBS Open Bio. 2017 Jan 11;7(2):204-220.

Feb. 13, 2017

Academic Institutions and Nonprofits only

#81218

pHu6-gRNA-NT1_SpecR backbone, gRNA for targeting the 3' region of pCALNL_Ch13 reporter

David Liu

Chaikind et al Nucleic Acids Res. 2016 Aug 11. pii: gkw

Nov. 4, 2016

Academic Institutions and Nonprofits only