We narrowed to 70,437 results for: des.1

#109008

CRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)

Jacob Corn

Liang et al J Cell Biol. 2018 Aug 24. pii: jcb.20180

Aug. 22, 2018

Academic Institutions and Nonprofits only

#110366

Mammalian expression of HisA-tagged HOXC6-1

Carlos Moreno

Ramachandran et al Oncogene. 2005 Jan 6;24(1):188-98. doi:

Jan. 30, 2020

Academic Institutions and Nonprofits only

#103160

Used to sense miRNA activity using fluorescence based tools. hsa-miR-1 target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor Comments

Ron Weiss

Gam et al Nat Commun. 2018 Jun 22;9(1):2430. doi:

Nov. 26, 2018

Academic Institutions and Nonprofits only

#112997

For protein expression and purification of Drosophila pumilio (amino acids 566-1090)

Terry Orr-Weaver

Hara et al Elife. 2018 Feb 26;7. pii: 33150. doi: 1

Aug. 3, 2018

Academic Institutions and Nonprofits only

#42316

Thierry Galli

Martinez-Arca et al J Cell Biol. 2000 May 15;149(4):889-900.

March 1, 2013

Academic Institutions and Nonprofits only

#110766

Bacterial expression of Met1 diUb

David Komander

Swatek et al Proc Natl Acad Sci U S A. 2018 Mar 6;115

June 13, 2018

Academic Institutions and Nonprofits only

#45063

Expression of constit active CaMKIV

Richard Maurer

Sun et al Genes Dev. 1994 Nov 1;8(21):2527-39.

Aug. 1, 2013

Academic Institutions and Nonprofits only

#31272

Tyler Jacks, Monte Winslow

Winslow et al Nature. 2011 May 5. 473(7345):101-4.

Sept. 27, 2011

Academic Institutions and Nonprofits only

#61079

Expresses a guide RNA (gRNA) to target human IRF-1 promoter

Hodaka Fujii

Fujita et al Biochem Biophys Res Commun. 2013 Sep 13;

Dec. 5, 2014

Academic Institutions and Nonprofits only

#85209

TRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.

Sandra Martha Gomes Dias

Quintero et al BMC Cancer. 2017 Nov 7;17(1):727. doi: 1

Oct. 4, 2017

Academic Institutions and Nonprofits only

#85734

Expresses DNA-binding (ETS) domain of murine PU.1, residues 167-272

Gregory Poon

Wang et al J Biol Chem. 2014 Aug 1;289(31):21605-16

Feb. 24, 2017

Academic Institutions and Nonprofits only