We narrowed to 23,934 results for: crispr
-
Plasmid#167678PurposeFinal destination vector for single Gateway LR reactionDepositorInsertPcUB4-2::spCas9
UseCRISPRAvailable SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
OA-1050J (GFP)
Plasmid#133304Purposeexpress arrays of gRNA targeting GFP under dU6-3 promoterDepositorInsertGFP gRNA array
ExpressionInsectPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCas9–mKate2ps–T1gRNA
Plasmid#62717Purposet1 gRNA (ATGAGAATCAAGGCGGTCGA)DepositorInsertCas9–mKate2ps
ExpressionMammalianAvailable SinceMay 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRU51
Plasmid#167677PurposeFinal destination vector for single Gateway LR reactionDepositorInsertPcUB4-2::spCas9
UseCRISPRAvailable SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMB63
Plasmid#47945PurposeExpresses C. elegans optimized Cas9 from the eef-1A.1 (eft-3) promoterDepositorInsertCas9
UseCRISPRTags3xFLAG, SV40 NLS, and egl-13 NLSExpressionWormPromotereef-1A.1 (eft-3)Available SinceDec. 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
NAX_CAGGS_CAS9_m4_KanR neo
Plasmid#167869PurposePiggyBac compatible plasmid expressing dCas9DepositorInsertdCas9
UseCRISPRMutationD10A, D839A, H840A, N863AAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
NAX_CAGGS_CAS9_m4_VPR_Hygro
Plasmid#167883PurposePiggyBac compatible plasmid expressing dCas9-VPRDepositorInsertdCas9-VPR
UseCRISPRMutationD10A, D839A, H840A, N863AAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
3xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2 probasin_mTQ2_FlpO
Plasmid#68405PurposeThe prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex8 and SMAD4 ex2. are expressed by the U6 promoterDepositorInserts3xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2
FlpO
UseCRISPRTagsmTurquoise2 (BFP)ExpressionMammalianPromoterSynthetic Probasin ARRx2 and U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pADH139
Plasmid#90987PurposeNAT-marked "empty" gRNA construct for use in gRNA expression cassette stitching PCR; use with pADH110 to generate target-specific part 2 of 2 for C.mal LEUpOUT CRISPR system.DepositorInsertgRNA conserved, C, mal LEU2 2 of 2
UseCRISPRAvailable SinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
NAX_CAGGS_CAS9_KanR neo
Plasmid#167861PurposePiggyBac compatible plasmid expressing spCas9DepositorInsertCas9
UseCRISPRAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMOD8A-RGR-r10
Plasmid#74370PurposeThis plasmid constitutively expresses gRNA-r10 from an AHD1 promoter using the RGR design. Integrates in the W303 HIS locus and restores HIS function.DepositorArticleInsertRGR-r10
UseCRISPR and Synthetic BiologyExpressionYeastPromoterADH1Available SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
sgRNA AAVS1
Plasmid#128119PurposeCo-expresses sgRNA AAVS1, SpyCas9 scaffold (F+E) and GFP (transfection marker)DepositorInsertsgRNA AAVS1 + GFP
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterRSV/U6Available SinceFeb. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCfB5191
Plasmid#126911PurposePlasmid containing gRNA expression cassettes targeting the X-4 and XII-5 integration sites in Saccharomyces cerevisiaeDepositorInsertX-4 and XII-5 gRNA
UseCRISPRAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTX172
Plasmid#89259PurposeExpress STU (Single Transcriptional Unit) Cas9 with Maize Ubiquitin1 promoter in plantsDepositorTypeEmpty backboneUseCRISPRTagsSV40 NLSExpressionPlantAvailable SinceMay 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTX176
Plasmid#89260PurposeExpress estrodial-inducible STU (Single Transcriptional Unit) Cas9 in plantsDepositorTypeEmpty backboneUseCRISPRTagsSV40 NLSExpressionPlantAvailable SinceMay 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
NAX_CAGGS_CAS9_m4_VPR_Puro
Plasmid#167887PurposePiggyBac compatible plasmid expressing dCas9-VPRDepositorInsertdCas9-VPR
UseCRISPRMutationD10A, D839A, H840A, N863AAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMOD8A-iRGR-r11
Plasmid#74369PurposeThis plasmid constitutively expresses gRNA-r11 from an AHD1 promoter using the insulated RGR design. Integrates in the W303 HIS locus and restores HIS function.DepositorArticleInsertRGR-r11
UseCRISPR and Synthetic BiologyExpressionYeastPromoterAHD1Available SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEF:iCas9
Plasmid#138267PurposeExpression of mTN3-GGS6-dCas9 (iCas9) in human.DepositorInsertmTN3-GGS6-dCas9
UseCRISPRExpressionMammalianMutationCas9-D10A, H840APromoterEf1aAvailable SinceMarch 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_M7NS_AmpR
Plasmid#119157PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR with seven mismatches in the non-seed regionDepositorInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, with seven mismatches in the non-seed region
UseCrisprPromoterJ23119Available SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_M2S_AmpR
Plasmid#119154PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR with two mismatches in the seed regionDepositorInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, with two mismatches in the seed region
UseCrisprPromoterJ23119Available SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only