We narrowed to 13,822 results for: aga
-
Plasmid#155056PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon2_1_As
Plasmid#155055PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon2_2_Lb
Plasmid#155052PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRRL-mouse cGAS #2-gRNA-Cas9-Puro
Plasmid#186891PurposegRNA targeting mouse cGAS (with Cas9 insert)DepositorInsertCas9 (Cgas Mouse)
UseLentiviralAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCold-I-Dsup
Plasmid#90021PurposeTo express His-tagged Dsup in bacteriaDepositorInsertDsup
TagsHisExpressionBacterialPromotercspAAvailable SinceMay 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-miniDi-P2A-mCherry
Plasmid#204358PurposeAAV vector for miniDi expression under the control of human synapsin promoterDepositorInsertminiDi-P2A-mCherry
UseAAVTagsmCherryMutationThe third intracellular loop (ICL3) of hM4Di was …PromoterhSynAvailable SinceOct. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-miniDq-P2A-mCherry
Plasmid#204357PurposeAAV vector for miniDq expression under the control of human synapsin promoterDepositorInsertminiDq-P2A-mCherry
UseAAVTagsmCherryMutationThe third intracellular loop (ICL3) of hM3Dq was …PromoterhSynAvailable SinceOct. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB-EF1α-H2B-PA-mCherry-PGKneo
Plasmid#247340PurposeExpresses photoactivatable H2B-Cherry under EF1 promoter and can be randomly integrated by PiggyBac transposaseDepositorAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNA 3C myc scfvFLAG
Plasmid#234990PurposeExpression of transmembrane region of Neuraminidase protein fused to an anti FLAG scFv antibody fragment for displaying on Viral like particles (VLPs) when cotranfected with GAG proteinDepositorInsertNA-3C-myc-scfvFLAG
ExpressionMammalianAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
tet_pLKO.1_puro_shNRF2 #1
Plasmid#136584PurposeExpresses an inducible short hairpin targeting human NRF2 sequenceDepositorAvailable SinceJune 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pStreptagII 3C SMO
Plasmid#234995PurposeExpression of a Strep-tag II labeled on its N-terminus receptor, with the Smoothened (Smo) receptorDepositorAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEABR NA 3C FLAG SA
Plasmid#234987PurposeFor production of Extracellular Vesicles (EVs), with the transmembrane region of Neuraminidase protein fused to Streptavidin on the vesicles surfaceDepositorInsertEABR-NA
TagsHRV 3C site, FLAG, Strep-Tactin (SA)ExpressionMammalianMutationIn the Streptavidin coding sequence Glu44Val/Ser4…Available SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmCherryC2-Gephyrin P1
Plasmid#68820PurposemCherry tagged Geph for mammalian expressionDepositorInsertGephyrin (Gphn Rat)
TagsmCherryExpressionMammalianMutationsilent mutations on internal EcoRI site. Gephyrin…PromoterCMVAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCW-HA-hRb-delta-CDK-T373D-S608D-S612D-puro
Plasmid#212675PurposeExpress tagged hRb phosphosite mutantDepositorInsertRb (RB1 Human)
UseLentiviralTagsHAMutation15 CDK phospho-sites are mutated to alanines, and…PromoterTREAvailable SinceAug. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX335-NQL002-WAPL-sgRNA1
Plasmid#175550PurposeFor transient expression of spCas9-nickase and one sgRNA targeting the mouse WAPL locus. Use together with pX335-NQL003-WAPL-sgRNA2 targeting construct.DepositorInsertspCas9-nickase and sgRNA against mouse WAPL STOP Codon
UseMouse TargetingExpressionMammalianAvailable SinceNov. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUDE710
Plasmid#103020Purposeexpression of a Cpf1 programming crRNA targeting ADE2 and HIS4 (crADE2-3 crHIS4-4.S)DepositorAvailable SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCR3-FLAG-Gephyrin GC
Plasmid#68818PurposeFlag tagged mammalian expression of GC domainDepositorAvailable SinceAug. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_PDPR_exon_deletion_1
Plasmid#155065PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJuly 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCR3-FLAG-Gephyrin G
Plasmid#68817PurposeGeph G domain expression in mamalian cellsDepositorAvailable SinceAug. 28, 2015AvailabilityAcademic Institutions and Nonprofits only