We narrowed to 3,439 results for: aaas
-
Plasmid#180648PurposeLentiviral expression vector for SPASTIN. Has F124D mutation. Used for generating cell lines. Has N-terminal mCherry tag. Dox-inducible. SPASTIN starts on M87. Internal ID: WISP20-44.DepositorInsertSPASTIN
UseLentiviralTagsmCherryExpressionMammalianMutationStarts at M87, F124D mutation, has siRNA resistan…Available SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P REV3L_2
Plasmid#160798PurposeSuppress REV3LDepositorInsertshREV3L_2
UseLentiviralAvailable SinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgGabrg1
Plasmid#124870PurposeMutagenesis of Gabrg1DepositorInsertGabrg1 (Gabrg1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
PLK1 gRNA (BRDN0001145759)
Plasmid#76457Purpose3rd generation lentiviral gRNA plasmid targeting human PLK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTER E2F3shRNA human
Plasmid#66885PurposeDoxycycline-regulated mammalian expression vector for expressing shRNA against E2F3DepositorAvailable SinceJune 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
sgRNA4_IL1RN
Plasmid#64152PurposePhotoactivatable transcription system. Lentiviral expression of IL1RN sgRNA4. Also contains a CMV-puro-t2A-mCherry expression cassetteDepositorAvailable SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAPM-D4 miR30-DNMT3a ts3
Plasmid#115867PurposeDNMT3a knockdownDepositorAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-2-TGFBR2-m3_3'UTR
Plasmid#31883DepositorInsertTGFBR2 mutant 3'UTR (TGFBR2 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationThird miR-302b, 372 7-mer seed match mutated from…PromoterSV40Available SinceSept. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
pMIR-CDH1 mutUTR
Plasmid#25039DepositorInsertCDH1 mutant 3'UTR (CDH1 Human)
UseLuciferaseExpressionMammalianMutationsubstitution of 6nt within the miR-9 binding site…Available SinceJune 7, 2010AvailabilityAcademic Institutions and Nonprofits only -
PIP5K1A gRNA (BRDN0001147757)
Plasmid#77963Purpose3rd generation lentiviral gRNA plasmid targeting human PIP5K1ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIP5K1A gRNA (BRDN0001147420)
Plasmid#77964Purpose3rd generation lentiviral gRNA plasmid targeting human PIP5K1ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgGabrg1
Plasmid#124856PurposeMutagenesis of Gabrg1DepositorInsertGabrg1 (Gabrg1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV_mU6-sgNGN3_hU6-sgRNA_hUbC-PuroR-P2A-GFP
Plasmid#162336PurposeLentiviral expression of sgNGN3 paired with a second S. pyogenes sgRNA with a GFP-P2A-PuroR selection markerDepositorInsertS. pyogenes sgRNA
UseLentiviralExpressionMammalianPromoterhU6; mU6Available SinceFeb. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pPN099
Plasmid#91626PurposeExpress sgRNA targeting human HCN1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAPM-D4 miR30-SETDB1 ts3
Plasmid#115861PurposeSETDB1 knockdownDepositorAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
ZAP70 gRNA (BRDN0001148252)
Plasmid#77955Purpose3rd generation lentiviral gRNA plasmid targeting human ZAP70DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
sgp27#1
Plasmid#102759PurposeExpresses sgRNA targeting mouse p27DepositorAvailable SinceNov. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
ROR1 gRNA (BRDN0001162245)
Plasmid#76043Purpose3rd generation lentiviral gRNA plasmid targeting human ROR1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only