We narrowed to 15,952 results for: grna
-
Plasmid#139094PurposeExpresses human codon-optimized inactive SpCas9 fused to a transcriptional repressor KRAB in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a barcode downstream of sgRNA cassette.DepositorInsertKRAB-dSpCas9
UseCRISPR and LentiviralExpressionMammalianMutationD10A, H840AAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJin-290
Plasmid#125718PurposeABA-inducible split T7 gRNA for GFP vector using RNAPN d5-19 with CGG RNAP-CDepositorInsertPCGG-gRNA GFP-off expression, FKBP-linker-T7 RNAPC, T7 RNAPN (d5-19)-linker-FRB
ExpressionMammalianAvailable SinceMay 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV-CS-154
Plasmid#166230Purposelenti-U6-gRNA::CMVp-nCas9-PmCDA1-UGI-2A-mCherryDepositorInsertsU6-gRNA EGFP targetting
nCas9-PmCDA1-UGI-2A-mCherry
UseCRISPR and LentiviralPromoterCMV promoter and Human U6Available SinceDec. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
Zebrafish-gRNA-0004
Plasmid#42244PurposegRNA targeted to zebrafish gene fh [site #2]DepositorAvailable SinceJan. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDECKO-mCherry GFP
Plasmid#78535PurposeControl plasmid (paired gRNAs against GFP)DepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralExpressionMammalianPromoterU6 (for expressing sgRNA) and U6 promoterAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMOD_C2517
Plasmid#91086PurposeModule C, Promoter: TaU3, Gene: Esp3I ccdb cassette for single gRNA spacer cloning (+ BaeI site for GT donor cloning), Terminator: Pol IIIDepositorInsertEsp3I ccdb cassette for single gRNA spacer cloning (+ BaeI site for GT donor cloning)
UseCRISPRPromoterTaU3Available SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMOD_C2520
Plasmid#91089PurposeModule C, Promoter: OsU6, Gene: Esp3I ccdb cassette for single gRNA spacer cloning (+ BaeI site for GT donor cloning), Terminator: Pol IIIDepositorInsertEsp3I ccdb cassette for single gRNA spacer cloning (+ BaeI site for GT donor cloning)
UseCRISPRPromoterOsU6Available SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
MDM4_Deletion_Upstream_gRNA_2
Plasmid#195135PurposegRNA in a third generation Cas9 vector with GFP, targeting region immediately upstream of MDM4, to be used with MDM4_Deletion_Downstream_gRNA_1/2 for MDM4 deletionDepositorInsertMDM4 Deletion Upstream gRNA 2 (MDM4 Human)
ExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
MDM4_Deletion_Upstream_gRNA_1
Plasmid#195134PurposegRNA in a third generation Cas9 vector with GFP, targeting region immediately upstream of MDM4, to be used with MDM4_Deletion_Downstream_gRNA_1/2 for MDM4 deletionDepositorInsertMDM4 Deletion Upstream gRNA 1 (MDM4 Human)
ExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgArhgap35#2/Cre
Plasmid#173570PurposeExpresses a Arhgap35-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Arhgap35 (Grlf1 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceApril 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgArhgap35#1/Cre
Plasmid#173569PurposeExpresses a Arhgap35-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Arhgap35 (Grlf1 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceApril 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFH113
Plasmid#128210Purposeimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with TaU3 promoter module (pFH31)DepositorInsertimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with TaU3 promoter module (pFH31)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pML45
Plasmid#206995PurposeContains gRNA targeting mouse Ptbp1 gene and Cas9 ORF.DepositorAvailable SinceOct. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
RUBY-ABE#2
Plasmid#232176PurposeT-DNA vector with ecTadA8e-zCas9D10A and corresponding sgRNA to correct RUBYm2 and recover a vivid red color visible to the naked eyes.DepositorInsert2x35s-ecTadA8e-SpCas9-D10A-AtU3-sgRNA-mis4-gRNA scaffold
UseCRISPRTags3xflag and NLSExpressionPlantAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT58
Plasmid#223430PurposeT-DNA vector for dSpCas9 mediated gene activation for monocot plants; NGG PAM; dSpCas9-Act3.0 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-dSpCas9-Act3.0-OsU3-gRNA scaffold 2.0
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT59
Plasmid#223431PurposeT-DNA vector for dSpCas9 mediated gene activation for monocot plants; NGG PAM; dSpCas9-Act3.0 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-dSpCas9-Act3.0-OsU3-gRNA scaffold 2.0
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXPR_023d-sgCiSF3B1
Plasmid#202446PurposeExpression of a CRISPRi guide targeting SF3B1DepositorAvailable SinceJune 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSIN-Ski-gRNA2
Plasmid#180369Purposetargeting mouse Ski geneDepositorAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHBS952 TARDBP-Exon1-ko-sgRNA1-SpCas9
Plasmid#107857PurposeTo knock-out TDP43DepositorInsertgRNA against TARDBP (Exon 1) (TARDBP Human)
ExpressionMammalianAvailable SinceJune 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only