We narrowed to 16,228 results for: sgRNA
-
Plasmid#124545PurposeCloning vector for tRNA-released sgRNA. BsmBI flanked placeholder for spacer cloning.DepositorInsertdelta-hutRNApro_BsmBIplch-sgRNA_14nt Buffer_delta-hutRNApro
ExpressionMammalianMutationd11-41, d11-41PromoterMinimal ADEAvailable SinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
8xCTS1_deltaC55A-hutRNApro_BsmBIplch-sgRNA_14nt Buffer_delta-hutRNApro_SV40polyA
Plasmid#124544PurposeCloning vector for tRNA-released sgRNA. BsmBI flanked placeholder for spacer cloning.DepositorInsertdeltaC55A-hutRNApro_BsmBIplch-sgRNA_14nt Buffer_delta-hutRNApro
ExpressionMammalianMutationd11-41 C55A, d11-41PromoterMinimal ADEAvailable SinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
8xCTS1_delta-hutRNApro_BsmBIplch-SAMsgRNA_14nt Buffer_delta-hutRNApro_SV40polyA
Plasmid#124540PurposeCloning vector for tRNA-released synergistic activation mediator gRNA. BsmBI flanked placeholder for spacer cloning.DepositorInsertdelta-hutRNApro_BsmBIplch-SAMsgRNA_14nt Buffer_delta-hutRNApro
ExpressionMammalianMutationd11-41, d11-41PromoterMinimal ADEAvailable SinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
8xCTS1_deltaC55G-hutRNApro_BsmBIplch-SAMsgRNA_14nt Buffer_delta-hutRNApro_SV40polyA
Plasmid#124538PurposeCloning vector for tRNA-released synergistic activation mediator gRNA. BsmBI flanked placeholder for spacer cloning.DepositorInsertdeltaC55G-hutRNApro_BsmBIplch-SAMsgRNA_14nt Buffer_delta-hutRNApro
ExpressionMammalianMutationd11-41 C55G, d11-41PromoterMinimal ADEAvailable SinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pT2K-CAGGS-U6-sgRNA-M9-IRES-CFP
Plasmid#114731PurposesgRNA targeting a sequence upstream of the initiator ATG of the cellular Myc geneDepositorInsertsgRNA M9
UseCRISPRExpressionMammalianAvailable SinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro U6 sgRNA SOX17 -126
Plasmid#50924PurposeU6 driven sgRNA targeting Sox17 -126 bp from TSSDepositorAvailable SinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
Px458-Cas9n-Trp73-Exon4-3sgRNA
Plasmid#88850PurposeCRISPR KO of Trp73DepositorAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
Px458-Cas9n-Trp73-Exon4-4sgRNA
Plasmid#88851PurposeCRISPR KO of Trp73DepositorAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMD19T-slr0230-PL31-sgRNANT1-KmR
Plasmid#73221PurposeContains sgRNA which targets GFPmut3b. Under an aTc inducible promoter. Suicide vector inserts into slr0230 site of Synechocystis. Carries kanamycin resistance. Propogates in E. coliDepositorInsertPL31-sgRNA NT1
ExpressionBacterialPromoterPL31Available SinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro U6 sgRNA SOX17 -296
Plasmid#50926PurposeU6 driven sgRNA targeting Sox17 -296 bp from TSSDepositorAvailable SinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-ZNF91-BFP
Plasmid#202823PurposeLentiviral vector modified to express two sgRNAs that delete exon 1 within the ZNF91 gene with EF-1apha for Cas9 and BFP expressionDepositorInserttwo sgRNAs (each with a U6 promoter) to delete exon 1 within ZNF91 gene
UseLentiviralExpressionMammalianPromoterU6 - twoAvailable SinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA23-sgRNA vector-U6-sgTS2 (SpCas9)
Plasmid#199454PurposeU6-driven sgRNA targeting TS2 sequence (GGAGCTTACTGAGACTCTTC)DepositorInsertTS2 sgRNA
UseCRISPRPromotermouse U6Available SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgRNA(OXTR.2)-CMV-eGFP
Plasmid#194016PurposeExpresses a gRNA that targets OXTR coding sequence in multiple (rodent) species and eGFPDepositorInsertssgRNA(Oxtr.2)
eGFP
UseAAV and CRISPRExpressionMammalianPromotercmb and u6Available SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-AsCpf1-2A-GFP-U6-tdTomato-sgRNA
Plasmid#194724Purposebased on (CAGGS-AsCpf1-2A-GFP-U6-sgRNA-cloning vector, Addgene 159281), with guide RNA that target tdTomatoDepositorArticleInsertAsCpf1
UseCRISPRExpressionMammalianAvailable SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
RPS4X sgRNA-3 lentiCRISPR v2-Blast plasmid
Plasmid#192233Purposelentiviral vector expressing sgRNA-3 targeting eIF3 binding site of RPS4X 5'UTRDepositorInsertsgRNA-3 targeting eIF3 binding site of RPS4X 5'UTR (RPS4X Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPS15A sgRNA-5 lentiCRISPR v2-Blast plasmid
Plasmid#192230Purposelentiviral vector expressing sgRNA-5 targeting eIF3 binding site of RPS15A 5'UTRDepositorInsertsgRNA-5 targeting eIF3 binding site of RPS15A 5'UTR (RPS15A Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPS4X sgRNA-4 lentiCRISPR v2-Blast plasmid
Plasmid#192234Purposelentiviral vector expressing sgRNA-4 targeting eIF3 binding site of RPS4X 5'UTRDepositorInsertsgRNA-4 targeting eIF3 binding site of RPS4X 5'UTR (RPS4X Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPS15A sgRNA-4 lentiCRISPR v2-Blast plasmid
Plasmid#192229Purposelentiviral vector expressing sgRNA-4 targeting eIF3 binding site of RPS15A 5'UTRDepositorInsertsgRNA-4 targeting eIF3 binding site of RPS15A 5'UTR (RPS15A Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
px459-Flag-Mcm2 targeting sgRNA
Plasmid#186937PurposeGenomic targeting of Flag tag at Mcm2 N-terminalDepositorAvailable SinceAug. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9-2A-GFP-sgRNA-RDH11
Plasmid#161924PurposeTo generate RDH11 KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against RDH11 exon 2.DepositorInsertsgRNA targeting RDH11 exon 2
UseCRISPRExpressionMammalianPromoterU6Available SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only