We narrowed to 25,213 results for: grna
-
Plasmid#195021PurposeSequence specific sgRNA that guide Cas9 to the genomic region encoding the bovine Creb5 DNA binding domainDepositorAvailable sinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pOC4 Actb-mRuby3 KI
Plasmid#183437PurposeFlpON knock-in for mRuby3-beta-actin (amino acid position: before start codon)DepositorInsertgRNA and mRuby3 donor
UseCRISPRExpressionMammalianAvailable sinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Tubb3-4xGFP KI
Plasmid#183445PurposeGFP knock-in for beta3-tubulin-GFP (amino acid position: stop codon)DepositorInsertgRNA and 4xGFP donor
UseCRISPRExpressionMammalianAvailable sinceApril 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
CMVp-dsRed2-Triplex-28-gRNA1-28-pA
Plasmid#55200PurposePlasmid encoding the Triplex/gRNA architecture.This is a modified form of the original plasmid described in the paper (Construct 3). mKate2 was replaced with dsRed2 because of distribution issues.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertdsRed2
UseSynthetic BiologyExpressionMammalianPromoterCMVAvailable sinceJune 16, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Hbb
Plasmid#99692PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Hbb, vector allows for strong activation of mouse Hbb, can be packaged and delivered as AAVDepositorPublicationAvailable sinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRS316-RGR-GFP
Plasmid#51056PurposeExpress self-cleaving-ribozyme-flanked sgRNA cassette (RGR) targeting GFP for CRISPR systems in yeast driven by ADH1 promoter. RGR has a HH ribozyme at its 5', and an HDV ribozyme at its 3'.DepositorInsertRGR-GFP
UseCRISPRExpressionBacterial and YeastPromoterYeast ADH1 promoterAvailable sinceFeb. 11, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pBzCas13b-gRNA-2
Plasmid#164859PurposeConstitutive expression of single-spacer CRISPR array with spacer #2 targeting deGFP mRNA for BzCas13b in bacteria.DepositorInsertBzCas13b-gRNA-2
ExpressionBacterialPromoterJ23119Available sinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBzCas13b-gRNA-3
Plasmid#164860PurposeConstitutive expression of single-spacer CRISPR array with spacer #3 targeting deGFP mRNA for BzCas13b in bacteria.DepositorInsertBzCas13b-gRNA-3
ExpressionBacterialPromoterJ23119Available sinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLsCas13a-gRNA-3
Plasmid#164867PurposeConstitutive expression of single-spacer CRISPR array with spacer #3 targeting deGFP mRNA for LsCas13a in bacteria.DepositorInsertLsCas13a-gRNA-3
UseCRISPRExpressionBacterialPromoterJ23119Available sinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLsCas13a-gRNA-2
Plasmid#164866PurposeConstitutive expression of single-spacer CRISPR array with spacer #2 targeting deGFP mRNA for LsCas13a in bacteria.DepositorInsertLsCas13a-gRNA-2
UseCRISPRExpressionBacterialPromoterJ23119Available sinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPEPX-P3-sgRNAluc
Plasmid#85590PurposeIntegrate plasmid of Streptococcus pneumoniae, which can integrate sgRNA targeting luc gene, which encode luciferase, into the locus between amiF and treR. This vector can be used as the template forDepositorInsertsgRNA targeting firefly luciferase encoding gene
UseCRISPRExpressionBacterialPromoterP3Available sinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pU6-sgRosa26-1_CBh-Cas9-T2A-BFP-P2A-Ad4E1B
Plasmid#64219PurposeExpression vector for a sgRNA against the mouse Rosa26 locus and Cas9 linked via T2A to BFP linked to the Ad4 E1B55K gene via P2ADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsCas9
sgRNA targeting ROSA26-1
UseCRISPRTags3xFLAG, NLS, and T2A-BFP-P2A-E1BExpressionMammalianPromoterCBh and U6Available sinceMay 19, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
lentiCRISPR - EGFP sgRNA 5
Plasmid#51764PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 5
UseCRISPR and LentiviralPromoterEFS and U6Available sinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
sgPBRM1-1- LentiCRISPRv2
Plasmid#107403PurposeLentiviral expression of Cas9 and gRNA targeting PBRM1DepositorInsertgRNA targeting PBRM1 (PBRM1 Human)
UseLentiviralAvailable sinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
gRNA Cloning Vector Bbs I ver. 2
Plasmid#85586PurposeAn empty sgRNA expression vector. sgRNA sequence can be cloned into its Bbs I site. Its gRNA scaffold has efficient ver. 2 structure.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available sinceDec. 5, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
gRNA-CasRx_SD1-pSV40-TagBFP
Plasmid#221004PurposeTransiently express CasRx DR30 repeat with gRNA spacer. Contains SD1 mutation to enhance efficiency. SV40-TagBFP cassette to monitor transfection efficiency. Use BbsI with overhangs Fw-AAAC, Rv-AAAA.DepositorInsertCasRx 30nt processed direct repeat with SD1 mutation
UseCRISPRExpressionMammalianMutationDR1 A>TPromoterU6Available sinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR_eGFP_497
Plasmid#111824PurposeKnockout eGFPDepositorInsertgRNA targeting eGFP 477-497
UseCRISPRTagsmCherryExpressionBacterial and MammalianPromoterU6Available sinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_RNF123
Plasmid#127122DepositorInsertgRNA RNF123 (RNF123 Human)
UseCRISPRAvailable sinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTC362
Plasmid#91216Purposeprotoplast vector for targeted deletion of 6 genes in tomatoDepositorInsertgRNAs targeting 6 tomato genes
UseCRISPRExpressionPlantAvailable sinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only