We narrowed to 25,285 results for: crispr
-
Plasmid#173843PurposeA knockout vector for the dog Ereg.DepositorInsertA gRNA targeting the dog Ereg gene and the cDNA of CRISPR-Cas9
UseCRISPR and LentiviralAvailable sinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-puro-dEgfr
Plasmid#173844PurposeA knockout vector for the dog Egfr.DepositorInsertA gRNA targeting the dog Egfr gene and the cDNA of CRISPR-Cas9
UseCRISPR and LentiviralAvailable sinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-UPP1_sgRNA1
Plasmid#201634PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertUPP1 (UPP1 Human)
UseCRISPR and LentiviralAvailable sinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
PX459-gR2A_Hinge
Plasmid#124811PurposeVector for expression Cas9 with gRNA specific for rat IgG2a heavy chain locus. Use in combination with pHybr_r2a>Fab-srt-his plasmids to convert expression of hybridomas to Fab' fragments.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCas9 – gRNA_R2A_hinge
UseCRISPRTags3XFLAG and GFPExpressionBacterial and MammalianMutationR166H in PuroR (please see depositors comment bel…PromoterpUCAvailable sinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pTE4566
Plasmid#88904PurposeExpresses MbCpf1 crRNA and inactive/dead, humanized MbCpf1 nucleaseDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsMb crRNA
hMbCpf1(D986A)
UseCRISPRTags3xHA and NLSExpressionMammalianPromoterCMV and human U6Available sinceApril 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available sinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAaePUb::Cas9-2A-Neo
Plasmid#176680PurposeExpression of Drosophila codon optimized spCas9 under Ae. aegypti Polyubiquitin promoter (AAEL003888)DepositorInsertspCas9; NeoR (aminoglycoside phosphotransferase from Tn5)
UseCrisprExpressionInsectMutationDrosophila codon optimizedPromoterAe. aegypti poly-ubiquitin (AAEL003888)Available sinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
GESTALT_pX330-v1
Plasmid#103061Purposeplasmid px330 with guide targeting GESTALT v1 through V5 constructsDepositorInsertintegration of Cas9 with guide targeting GESTALT barcodes V1 to V5
UseLentiviralAvailable sinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
p15a_Kan_MLS_Rosa26_Short_CRISPRDel_CAG_RNeoStop_WPRE_bgh_pA
Plasmid#97011PurposeRosa26 targeting vector for Dre-responsive cassetteDepositorTypeEmpty backboneUseCRISPR and Cre/LoxExpressionMammalianAvailable sinceMarch 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNSA-ARS-CRISPR-BlastR
Plasmid#101009PurposeExpresses Cas9-Nlux and sgRNA and contains CEN/ARS. CCMP537 LDSP promoter driven Blasticidin resistance gene.DepositorTypeEmpty backboneUseAlgae, nannochloropsisAvailable sinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
CRISPR-StAR1 (Retro)
Plasmid#222687PurposeCRISPR-screeningDepositorTypeEmpty backboneUseCRISPR and RetroviralExpressionMammalianMutationPGK without BbsI cutsiteAvailable sinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEJS2701-CMV-Nme2Smu-ABE8e-nt-E932R
Plasmid#228722PurposeExpresses N-terminal ABE8e-Nme2Smu nCas9 (D16A) base editor with E932R mutation in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertN-terminal ABE8e with Nme2Smu nCas9 (D16A) E932R
UseCRISPRExpressionMammalianMutationNme2-Cas9, Smu PID, D16A E932RPromoterCMVAvailable sinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2_cGAS_gRNA_3
Plasmid#235531PurposegRNA against human cGASDepositorInsertcGAS (CGAS Human)
UseLentiviralAvailable sinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR_Puro_sgAAVS1
Plasmid#187818PurposepLentiCRISPR that is selectable with puromycin with an sgRNA targeting AAVS1DepositorInsertsgAAVS1
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceAug. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVC-CRISPR1
Plasmid#120366PurposePlasmid containing shortened version of upstream V-C CRISPR array for integration assaysDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCRISPR1
UseCRISPRAvailable sinceApril 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVC-CRISPR
Plasmid#120369PurposePlasmid containing shortened versions of both natural V-C CRISPR arrays for preparing sequencing libraryDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsCRISPR1
CRISPR2
UseCRISPRAvailable sinceApril 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD1CB0001
Plasmid#185625PurposeMoClo Level 1, position 2 reverse, transcriptional unit for expression of plant codon optimized Cas9 from Streptococcus pyogenes driven by 35S promoterDepositorInsertSpCas9
UseCRISPR and Synthetic BiologyAvailable sinceAug. 4, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMS1: pHelper(AvCAST)_AvPSP1
Plasmid#168133PurposeInducible expression of AvCAST proteins with crRNA targeting AvPSP1.DepositorInsertsAvCAST minimal CRISPR array (with spacer for AvPSP1)
AvCAST Cascade proteins (Cas6, Cas8, Cas7 and Cas5)
AvCAST Tns proteins (TnsA, TnsB, TnsC and TniQ)
AvTnsD
ExpressionBacterialAvailable sinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2 EGFP sgRNA1
Plasmid#164932PurposeExpresses EGFP sgRNA1 in mammalian cellsDepositorInsertsgRNA1 targeting Enhanced green fluorescent protein (verified for knockout)
UseLentiviralPromoterEFS promoterAvailable sinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFVp-CRISPRoffv2.1-IRES-BlastR
Plasmid#207181PurposeLentiviral Expression Plasmid for CRISPRoff2.1 driven by SFFV PromoterDepositorPublicationInsertCRISPRoffv2.1
UseCRISPR and LentiviralTagsHA and TagBFPExpressionMammalianPromoterSFFVpAvailable sinceApril 25, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by