We narrowed to 58,592 results for: plasmid
-
Plasmid#32520DepositorInsertConstitutively active Rheb (S16H) (Rheb Rat)
UseLentiviralExpressionMammalianMutationS16H to make constitutively activePromoterCMVAvailable SinceSept. 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
pGL3-human OCT4 PE-SV40-Luc
Plasmid#52415PurposeLuciferase reporter plasmid for PE OCT4 enhancer activityDepositorAvailable SinceSept. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-eYFP (AAV5)
Viral Prep#117382-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-hSyn1-eYFP (#117382). In addition to the viral particles, you will also receive purified pAAV-hSyn1-eYFP plasmid DNA. hSyn-driven eYFP expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagseYFPAvailable SinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-tdTomato (AAV2)
Viral Prep#28306-AAV2PurposeReady-to-use AAV2 particles produced from pAAV-FLEX-tdTomato (#28306). In addition to the viral particles, you will also receive purified pAAV-FLEX-tdTomato plasmid DNA. CAG-driven, Cre-dependent tdTomato expression control. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagstdTomato (Cre-dependent)Available SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-FLEX-jGCaMP8f-WPRE (AAV Retrograde)
Viral Prep#162379-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pGP-AAV-syn-FLEX-jGCaMP8f-WPRE (#162379). In addition to the viral particles, you will also receive purified pGP-AAV-syn-FLEX-jGCaMP8f-WPRE plasmid DNA. Syn-driven, Cre-dependent expression of the ultrafast calcium sensor, GCaMP8f. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceJune 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV pEF1a-DIO-FLPo-WPRE-hGHpA (AAV9)
Viral Prep#87306-AAV9PurposeReady-to-use AAV9 particles produced from AAV pEF1a-DIO-FLPo-WPRE-hGHpA (#87306). In addition to the viral particles, you will also receive purified AAV pEF1a-DIO-FLPo-WPRE-hGHpA plasmid DNA. EF1a-driven, Cre dependent expression of the site-specific recombinase FlpO. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-Cre-P2A-dTomato (AAV8)
Viral Prep#107738-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-hSyn-Cre-P2A-dTomato (#107738). In addition to the viral particles, you will also receive purified pAAV-hSyn-Cre-P2A-dTomato plasmid DNA. hSyn-driven expression of Cre and dTomato (physically separate). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsdTomato (physically separate, not a fusion protein)Available SinceNov. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPP085
Plasmid#158795PurposepRSF-Duet1 derived plasmid containing C-terminally hexa-histidine tagged CasΦ-2 in MCS1 for expression in E. coli and protein purificationDepositorInsertCasPhi-2
Tags6xHisExpressionBacterialAvailable SinceAug. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-HOT_tdTomato
Plasmid#138567PurposeUniversal Cleavable Donor Plasmid for tagging with tdTomato using NHEJDepositorInserttdTomato
UseUnspecifiedAvailable SinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-HOT-P2A-Clover-BlastR
Plasmid#138568PurposeUniversal Cleavable Donor Plasmid for tagging with P2A-Clover-BlastR using NHEJDepositorInsertP2A-clover-BlastR
UseCRISPRAvailable SinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pQE30-His-PheRS
Plasmid#124116PurposeBacterial expression plasmid for PURE system componentsDepositorAvailable SinceJune 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET21a-SerRS-His
Plasmid#124118PurposeBacterial expression plasmid for PURE system componentsDepositorAvailable SinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET21a-LysRS-His
Plasmid#124114PurposeBacterial expression plasmid for PURE system componentsDepositorAvailable SinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
sgCtr- LentiCRISPRv2
Plasmid#107402PurposeLentiviral expression of Cas9 and a control gRNADepositorInsertcontrol gRNA
UseLentiviralAvailable SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_SPOP_WT
Plasmid#81856PurposeGateway Donor vector containing SPOP ,part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_KRAS_p.G12D
Plasmid#81651PurposeGateway Donor vector containing KRAS, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDonor-tBFP-NLS-Neo (Universal)
Plasmid#80767PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorInsertPITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pST44
Plasmid#64007Purposepolycistronic cloning vector for pST44 plasmid suiteDepositorTypeEmpty backboneExpressionBacterialPromoterT7Available SinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C3-Sec5
Plasmid#53756PurposepEGFP-C3 plasmid that expresses Sec5DepositorAvailable SinceJuly 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSimpleII-NLS-NmCas9-HA-NLS(s)
Plasmid#47867PurposeThis plasmid encode NmCas9 with two NLS and a HA tagDepositorInsertNmCas9
UseCRISPRTagsHA and NLSExpressionMammalianPromoterEF1aAvailable SinceSept. 25, 2013AvailabilityAcademic Institutions and Nonprofits only