We narrowed to 11,464 results for: poly
-
Plasmid#68650PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneTagsModified EAR motif plant-specific repression doma…ExpressionPlantPromoterCauliflower mosaic virus 35S promoterAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pcDNA4/TO CD16.7-h-PKD1 FLM W4108A
Plasmid#83462PurposeCytoplasmic tail of human PC1 expression cassette with a membrane anchor and a mutation in the first Calmodulin binding domain (502)DepositorInsertPolycystin-1 (PKD1 Human)
TagsCD16.7ExpressionMammalianMutationAmino-acids 4078-4303, W4107AAvailable SinceNov. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO CD16.7-h-PKD1 FLM S4144D
Plasmid#83460PurposeCytoplasmic tail of human PC1 expression cassette with a membrane anchor and a point mutant that disrupts the second calmodulin binding domain (513)DepositorInsertPolycystin-1 (PKD1 Human)
TagsCD16.7ExpressionMammalianMutationAmino-acids 4078-4303, S4144DAvailable SinceNov. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO CD16.7-h-PKD1 FLM (4078-4169)
Plasmid#83463PurposeCytoplasmic tail of human PC1 expression cassette with a membrane anchor and PKD1 sequence that corresponds to 4078 to 4169 of PC1 (96)DepositorAvailable SinceNov. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO h-PKD1 FLS S4144D-Myc/His
Plasmid#83459PurposeHuman PC1-CTp30 expression cassette with a point mutant that disrupts the second calmodulin binding domain (514)DepositorInsertPolycystin-1 (PKD1 Human)
Tags6xHis and MycExpressionMammalianMutationAmino-acids 4107-4303, S4144DAvailable SinceNov. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO h-PKD1 FLS (4127-4303)-Myc/His
Plasmid#83457PurposeHuman PC1-CTp30 expression cassette lacking a Calmodulin binding domain (delta C1) (632)DepositorInsertPolycystin-1 (PKD1 Human)
Tags6xHis and MycExpressionMammalianMutationAmino-acids 4127-4303Available SinceNov. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO h-PKD1 FLS L4137P-GST
Plasmid#83455PurposeHuman PC1-CTp30 expression cassette with a patient mutation at L4137 and a GST-tag (848)DepositorInsertPolycystin-1 (PKD1 Human)
TagsGSTExpressionMammalianMutationAmino-acids 4107-4303, L4137PAvailable SinceNov. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO h-PKD1 FLS R4150C-GST
Plasmid#83454PurposeHuman PC1-CTp30 expression cassette with a patient mutation at R4150 and a GST-tag (850)DepositorInsertPolycystin-1 (PKD1 Human)
TagsGSTExpressionMammalianMutationAmino-acids 4107-4303, R4150CAvailable SinceNov. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB418
Plasmid#68683PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneTagsModified EAR motif plant-specific repression doma…ExpressionPlantPromoterMpEF1alpha promoterAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB421
Plasmid#68686PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneTagsModified EAR motif plant-specific repression doma…ExpressionPlantPromoterMpEF1alpha promoterAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCCM’
Plasmid#162709PurposepCCM reconstructed after selection for CCMB1 growth on glycerol under ambient airDepositorInsertSecond CCM operon cloned from H. neapolitanus
ExpressionBacterialMutationp15A origin replaced with high-copy colE1 originPromoterPLtet0-1 promoterAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
Renilla luciferase-Pol III
Plasmid#37380DepositorInsertPolIII-Renilla control reporter (RpIII128 Fly)
UseLuciferaseExpressionMammalianPromoterRNA PolIII 128 subunit (RpIII128)Available SinceJuly 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
MSCV-N BKV ER
Plasmid#37864DepositorUseRetroviralTagsFlag and HAExpressionMammalianPromoterPKGAvailable SinceJuly 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSLQ10873
Plasmid#183961PurposeU6-SKSKSO(crRNA array)-CAG-hyperdCas12a-HA-miniVPRDepositorInsertsHyperdCas12a
poly-crRNA array targeting Sox2-Klf4-Oct4
UseCRISPRTagsHAExpressionMammalianMutationD832A, D156R, E292R, D235R, D350RPromoterCAG and U6Available SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-A762V
Plasmid#174795PurposeBacterial expression of wild type PARP1 mutant (A762V is reversion of the common V762A polymorphism)DepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
FUW-C-prM-E-NS1
Plasmid#175281Purposelentiviral vector mediating bicistronic expression of the 4 genes of YFV-17D (C-prM-E-NS1) and EGFP.DepositorInsertC-prM-E-NS1 and EGFP (POLY Yellow fever virus strain 17D)
UseLentiviralTagsIRES EGFPPromoterhuman ubiquitin CAvailable SinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hPPP3CA-FLAG
Plasmid#179134PurposeExpression vector of human protein phosphatase 3, catalytic subunit, alpha isoform (PPP3CA) tagged with FLAG at C-terminus, CAG promoter, rabbit globin poly(A) signal.DepositorInsertprotein phosphatase 3, catalytic subunit, alpha isoform (PPP3CA Human)
TagsFLAGExpressionMammalianAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only