We narrowed to 23,478 results for: CRISPR
-
Plasmid#91727PurposeNAT-marked C. albicans URA3-specific gRNA expression construct; part 2 of 2 of C.alb LEUpOUT CRISPR system. Use with pADH137 CAS9 expression construct.DepositorInsertNAT 2of2, pSNR52, C. albicans URA3-specific gRNA, LEU2 2of2
UseTagsExpressionMutationPromoterAvailable SinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
Zebrafish-gRNA-0009
Plasmid#42249PurposegRNA targeted to zebrafish gene tph1aDepositorInsertgRNA-tph1a (tph1a Zebrafish)
UseCRISPR; Zebrafish expressionTagsExpressionMutationPromoterT7Available SinceJan. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
EF1a-dCas9-VP64
Plasmid#235595PurposeExpresses the dCas9-VP64 under the control of human EF1a promoterDepositorInsertdCas9-VP64
UseCRISPRTagsNLSExpressionMammalianMutationPromoterEF1aAvailable SinceMay 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT02
Plasmid#223374PurposeT-DNA vector for SpCas9 mediated mutagenesis for plants; NGG PAM; Cas9 was driven by ZmUbi1 and the sgRNA was driven by AtU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-SpCas9-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT04
Plasmid#223376PurposeT-DNA vector for SpCas9 mediated mutagenesis for monocot plants; NGG PAM; Cas9 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-SpCas9-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT06
Plasmid#223378PurposeT-DNA vector for SpCas9 mediated mutagenesis for monocot plants; NGG PAM; Cas9 was driven by ZmUbi1 and the sgRNA was driven by ZmUbi1 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-SpCas9-ZmUbi-gRNA scaffold-tRNA
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSExpressionMutationPromoterAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSExpressionMutationPromoterAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSExpressionMutationPromoterAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Kan
Plasmid#232102PurposeYeast CEN plasmid for estradiol-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with Z3 promoter and Z3EV transcription factor.DepositorTypeEmpty backboneUseCRISPRTagsExpressionYeastMutationPromoterAvailable SinceFeb. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Hyg
Plasmid#232101PurposeYeast CEN plasmid for estradiol-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with Z3 promoter and Z3EV transcription factor.DepositorTypeEmpty backboneUseCRISPRTagsExpressionYeastMutationPromoterAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas9-EcRT-Z3-Nat
Plasmid#232094PurposeYeast CEN plasmid for estradiol-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertZ3 promoter and Z3EV transcription factor
UseCRISPRTagsExpressionYeastMutationPromoterZ3Available SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDM028
Plasmid#216809PurposeVector for Aspergillus CRISPR-Cas9 genetic engineering with Golden Gate cloning drop-out cassette for protospacer insertion and hph selectable marker.DepositorTypeEmpty backboneUseCRISPR; Fungal expressionTagsExpressionBacterialMutationPromoterAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDM030
Plasmid#216810PurposeVector for Aspergillus CRISPR-Cas9 genetic engineering with Golden Gate cloning drop-out cassette for protospacer insertion and ble selectable marker.DepositorTypeEmpty backboneUseCRISPR; Fungal expressionTagsExpressionBacterialMutationPromoterAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRhaCAST
Plasmid#211791PurposepZLrhaB2plus with Sh-cas12K-tnsBC-tniQ cloned into, which drives by the rhamnose inducible promoterDepositorInsertShTnsB, ShTnsC, ShTniQ, ShCas12k, sgRNA scaffold for guide cloning
UseCRISPRTagsExpressionBacterialMutationPromoterRhamnose-inducibleAvailable SinceJune 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF823_EFS-Cas9-P2A-Puro
Plasmid#211645PurposeEFS-Cas9-P2A-PuroDepositorInsertCas9
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF226_EFS-Cas9-P2A-Puro
Plasmid#211644PurposeEFS-Cas9-P2A-PuroDepositorInsertCas9
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDL28_Cas9-His Δcys E532C/E1207C
Plasmid#206289PurposeBacterial expression of SpCas9 Δcys E532C and E1027C variant under T7 promoterDepositorInsertSpCas9
UseCRISPRTags6x-His and SV40 NLSExpressionBacterialMutationC80S, E532C, C574S, E1207CPromoterT7Available SinceSept. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDL27_Cas9-His Δcys E532C/E945C
Plasmid#206288PurposeBacterial expression of SpCas9 Δcys E532C and E945C variant under T7 promoterDepositorInsertSpCas9
UseCRISPRTags6x-His and SV40 NLSExpressionBacterialMutationC80S, E532C, C574S, E945CPromoterT7Available SinceSept. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDL26_Cas9-His Δcys M1C/E532C
Plasmid#206287PurposeBacterial expression of SpCas9 Δcys M1C and E532C variant under T7 promoterDepositorInsertSpCas9
UseCRISPRTags6x-His and SV40 NLSExpressionBacterialMutationM1C, C80S, E532C, C574SPromoterT7Available SinceSept. 18, 2023AvailabilityAcademic Institutions and Nonprofits only