We narrowed to 659 results for: pgk promoter
-
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDUAL CLDN (GFP)
Plasmid#86981PurposeLentiviral expression construct encoding Claudin-1 and GFP from separate promotersDepositorAvailable SinceFeb. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
cTRE-LSL-GFP-IRES-Cas9-sgCR8
Plasmid#135668PurposeIntroduce Dox/Cre-inducible (TRE promoter followed by lox-stop-lox) Cas9 cDNA plus control-targeting sgRNA into (ES) cells by recombination-mediated cassette exchangeDepositorInsertsgCR8
UseMouse TargetingAvailable SinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
cTRE-LSL-GFP-IRES-Cas9-sgPtenX1.1
Plasmid#135669PurposeIntroduce Dox/Cre-inducible (TRE promoter followed by lox-stop-lox) Cas9 cDNA plus Pten-targeting sgRNA into (ES) cells by recombination-mediated cassette exchangeDepositorInsertsgPten
UseMouse TargetingAvailable SinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLVPT-GDNF-tTR-KRAB
Plasmid#11646PurposeTet-regulated (Tet-on) lentiviral vector for GDNF (mPGK promoter) - 2nd generationDepositorAvailable SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGLS
Plasmid#110319PurposeshGLS (Target CAACTGGCCAAATTCAGTC), silence human GLS gene and express monomeric Kusabira-Orange2DepositorInsertGLS Glutaminase (GLS Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLVPT-GDNF-rtTR-KRAB-2SM2
Plasmid#11647PurposeTet-regulated (Tet-off) lentiviral vector for GDNF (mPGK promoter) - 2nd generationDepositorAvailable SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
pJH2972
Plasmid#100956PurposeCas9 driven by PGK1 promoter. gRNA can be cloned into the BplI sites. URA3MX markerDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceSept. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJH2970
Plasmid#100954PurposeCas9 driven by PGK1 promoter. gRNA can be cloned into the BplI sites. HIS3MX markerDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceSept. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pJH2971
Plasmid#100955PurposeCas9 driven by PGK1 promoter. gRNA can be cloned into the BplI sites. KANMX markerDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceSept. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
cTRE-PtenWT
Plasmid#135663PurposeIntroduce Dox-inducible (TRE promoter) wildtype Pten cDNA into (ES) cells by recombination-mediated cassette exchangeDepositorInsertPten (Pten Mouse)
UseMouse TargetingAvailable SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPL001-BBTK
Plasmid#184751PurposeBig-IN positive control payload encoding EF1a-driven GFP-T2A-BSD. Harbors a backbone counterselectable TK cassette.DepositorInsertpEF1a-eGFP-T2A-BSD-bGHpA
UseCre/Lox, Mouse Targeting, and Synthetic Biology ;…ExpressionMammalianPromoterEF1aAvailable SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
cTRE-PtenC124S
Plasmid#135664PurposeIntroduce Dox-inducible (TREa promoter) C124S-mutant Pten cDNA into (ES) cells by recombination-mediated cassette exchangeDepositorAvailable SinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP185 pLVP-dCas9-DNMT3a V2
Plasmid#100936PurposedCas9 and DNMT WT on C terminus, 4 NLS, driven by pGK promoter, with P2A site and PURO gene, within a lentiviral transfer backboneDepositorInsertdCas9, DNMT3a catalytic domain (DNMT3A S.pyogenes, Human)
UseCRISPR and LentiviralTags3xHA and 3xTy1ExpressionMammalianMutationD10A, H840A for dCas9Available SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
MSCVhyg-HA-FLAG_Ubc9_WT
Plasmid#164936PurposeExpresses FLAG & HA tagged human uman Ubiquitin Conjugating Enzyme 9 (UBC9) wild type cDNADepositorAvailable SinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
MSCVhyg-HA-FLAG_Ubc9_C93A
Plasmid#164937PurposeExpresses FLAG & HA tagged human Ubiquitin Conjugating Enzyme 9 (UBC9) _C93A mutant cDNADepositorAvailable SinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pimEJ5GFP
Plasmid#44026DepositorInsertEJ5GFP egfp-based chromosomal break reporter
ExpressionMammalianMutationpCAGGS promoter and eGFP separated by pgkPURO cas…PromoterpCAGGSAvailable SinceMay 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
bRA89
Plasmid#100950PurposeCas9 driven by PGK1 promoter. gRNA can be cloned into the BplI sites. HPH markerDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceSept. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
bRA90
Plasmid#100951PurposeCas9 driven by PGK1 promoter. gRNA can be cloned into the BplI sites. LEU2 markerDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceSept. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
AZ64_pE.DonorCLYBL.TS
Plasmid#199228PurposeDonor plasmid with CLYBL target sites for ITPN or HMEJ knock-in at the human CLYBL safe harbor locusDepositorInsertExpression unit for EGFP reporter
UseGene targeting donor plasmidExpressionMammalianPromoterHuman PGK1 gene promoterAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pILGFP9E3
Plasmid#185842PurposeTesting the TEF1 promoter inserted with 4 TetO elements using a green fluorescence protein as the reporterDepositorInsertPURA3>KlURA3>TAgTEF1-PTEF1+[TetO]>yEGFP>TPGK1-TURA3
ExpressionYeastMutationNoneAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pILGFP4D42
Plasmid#185840PurposeTesting the TEF1 promoter inserted with 4 Z268 elements using a green fluorescence protein as the reporterDepositorInsertPURA3>KlURA3>TAgTEF1-PTEF1+[Z268]>yEGFP>TPGK1-TURA3
ExpressionYeastMutationNoneAvailable SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
AD59_pEP.DonorCLYBL.TS
Plasmid#199227PurposeDonor plasmid with CLYBL target sites for ITPN or HMEJ knock-in at the human CLYBL safe harbor locusDepositorInsertExpression unit for PuroR.T2A.EGFP selectable and reporter markers
UseGene targeting donor plasmidExpressionMammalianPromoterHuman PGK1 gene promoterAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pILGFP3A2 (2)
Plasmid#185852PurposeTesting the TEF1 promoter appended with 3 tetracycline riboswitch using a green fluorescence protein as the reporterDepositorInsertPURA3>KlURA3>TAgTEF1-PTEF1>3*TcRb>yEGFP>TPGK1-TURA3
ExpressionYeastMutationNoneAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pILGFP3A2 (1)
Plasmid#185851PurposeTesting the TEF1 promoter appended with 2 tetracycline riboswitch using a green fluorescence protein as the reporterDepositorInsertPURA3>KlURA3>TAgTEF1-PTEF1>2*TcRb>yEGFP>TPGK1-TURA3
ExpressionYeastMutationNoneAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pILGFP4D41
Plasmid#185841PurposeTesting the CYC1 core promoter inserted with 4 Z268 elements using a green fluorescence protein as the reporterDepositorInsertPURA3>KlURA3>TAgTEF1-PCYC1+[Z268]>yEGFP>TPGK1-TURA3
ExpressionYeastMutationNoneAvailable SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
BB44_pmc.DonorR5.TS
Plasmid#199223PurposeDonor plasmid with CCR5 target sites for ITPN or HMEJ knock-in at the human CCR5 safe harbour locusDepositorInsertExpression unit for mCherry - monomeric derivative of DsRed fluorescent protein (Shaner et al., 2004)
UseGene targeting donor plasmidExpressionMammalianPromoterHuman PGK1 gene promoterAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEJS613_pTetR-P2A-BFPnls/sgTelo
Plasmid#108649PurposeTelomere-targeting Spy sgRNA under U6 promoterDepositorInsertsTelomere-targeting sgRNA
TetR-P2A-BFP
UseCRISPR and LentiviralTagsNoExpressionMammalianPromoterU6 and hPGKAvailable SinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEJS614_pTetR-P2A-BFPnls/sgNS
Plasmid#108650PurposeNon-specific Spy sgRNA under U6 promoterDepositorInsertsNon-specific sgRNA
TetR-P2A-BFP
UseCRISPR and LentiviralTagsNoExpressionMammalianPromoterU6 and hPGKAvailable SinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEJS887_pTetR-P2A-BFPnls/sgAlpha
Plasmid#108651PurposeAlpha satellite repeats targeting Spy sgRNA under U6 promoterDepositorInsertsAlpha satellite repeats targeting sgRNA
TetR-P2A-BFP
UseCRISPR and LentiviralTagsNoExpressionMammalianPromoterU6 and hPGKAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
MXS Chaining Kit
Plasmid Kit#1000000064PurposeMXS-chaining system for assembly of constructs optimized for synthetic biology applications in mammalian systems. 14 different fluorescent proteins, 10 mammalian promoters/enhancers, 3 polyA signalsDepositorAvailable SinceAug. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-shRNA
Plasmid#82697PurposeFor targeting shRNA construct into human AAVS1 locus, using genome editing. Expresses shRNA of interest (cloning: EcoRI and AgeI) under U6 promoter, flanked by AAVS1 homology arms.DepositorTypeEmpty backboneUseRNAiPromoterhPGK, U6Available SinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRRLsin-SV40 T antigen-IRES-mCherry
Plasmid#58993Purposelentiviral expression of SV40 large T antigen and mCherry red fluorescent reporterDepositorInsertsCMV enhancer-chicken beta actin promoter
SV40 large T antigen
IRES-mCherry red fluorescent protein
UseLentiviralExpressionMammalianMutationEcoRV site in MCS converted to BamHI sitePromoterCMV enhancer-chicken beta actinAvailable SinceSept. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNotch2#2/Cre
Plasmid#193226PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Notch2 geneDepositorAvailable SinceDec. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNotch2#1/Cre
Plasmid#193225PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Notch2 geneDepositorAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRunx1t1#2/Cre
Plasmid#193236PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Runx1t1 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only