We narrowed to 7,152 results for: CAD;
-
Plasmid#29506DepositorAvailable SinceApril 27, 2011AvailabilityAcademic Institutions and Nonprofits only
-
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 PARL-FLAG-CT S65D+T69D+S70D
Plasmid#13617DepositorTagsFLAGExpressionMammalianMutationchanged Serine 65, Thr 69 and Ser70 to AspAvailable SinceJan. 12, 2007AvailabilityAcademic Institutions and Nonprofits only -
pRvCAHS1-mEGFP-NLS
Plasmid#205013PurposeThe vector contains 1kbp of the upstream and downstream regions of the cahs1 gene from Ramazzottius varieornatus, with the mEGFP gene with NLS sequence positioned in between.DepositorInsertmEGFP-NLS flanked by 1kbp upstream and downstream of the cahs1 gene from Ramazzottius varieornatus
UseTardigrade expressionAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRvSAHS1-mCherry-NLS
Plasmid#205009PurposeThe vector contains 1kbp of the upstream and downstream regions of the sahs1 gene from Ramazzottius varieornatus, with the mCherry gene with NLS sequence positioned in between.DepositorInsertmCherry-NLS flanked by 1kbp upstream and downstream of the sahs1 gene from R. varieornatus
UseTardigrade expressionAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-CHD7 (1-1899)
Plasmid#170143PurposeExpresses residues 1-1899 of CHD7 in insect cellsDepositorInsertchromodomain helicase DNA binding protein 7 (CHD7 Human)
TagsFLAGExpressionInsectMutationC-terminal truncation of residues 1900-2997Available SinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-CHD7 (1-1547)
Plasmid#170144PurposeExpresses residues 1-1547 of CHD7 in insect cellsDepositorInsertchromodomain helicase DNA binding protein 7 (CHD7 Human)
TagsFLAGExpressionInsectMutationC-terminal truncation of residues 1548-2997Available SinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-CHD7 (K999R)
Plasmid#170142PurposeExpresses CHD7 (K999R) in insect cellsDepositorInsertchromodomain helicase DNA binding protein 7 (CHD7 Human)
Tags6xHis and FLAGExpressionInsectMutationK999RAvailable SinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOPS0380
Plasmid#133230PurposeReporter plasmid for R. leguminosarum suitable for experiments in environments where there is no antibiotic selection present.DepositorInsertconstructed with constitutive promoter Rlv3841pnifH (pOGG082), mCherry (EC15071) and T-pharma (pOGG003)
ExpressionBacterialMutationDomesticated for Golden Gate cloningAvailable SinceApril 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
p7612 MSCV-P C-FlagHA 16E7 E10K
Plasmid#163303PurposeExpresses HPV16 E7 E10KDepositorInsertHPV16 E7 E10K
UseRetroviralTagsFlagHAMutationE10KPromoterMSCV LTRAvailable SinceJan. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR.sgKras.9
Plasmid#91894PurposesgRNAs targeting mouse Kras. 3rd generation lentiviral backbone.DepositorInsertKras sgRNA
UseLentiviralPromoterU6Available SinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCru5-/CGA-mEGFP-IRES-mCherry
Plasmid#49224PurposeRetroviral expression vector. Contains an altered Kozak sequence and/or upstream open reading frames to modulate expression at the level of translation.DepositorInsertsmEGFP
mCherry
UseRetroviral and Synthetic BiologyTagsSfuI site to create C-terminal fusionsExpressionMammalianPromoterViral LTR (or CMV)Available SinceDec. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-Ef1a-mCh-GFPi
Plasmid#31849DepositorInsertGFP RNAi
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianPromoterU6 for shRNA; Ef1alpha for mCherryAvailable SinceJan. 3, 2012AvailabilityAcademic Institutions and Nonprofits only -
pT2-7xTcf-NLS-ONL
Plasmid#65713PurposeTol2-based Wnt signal reporter plasmid (expresses NLS-ONL)DepositorInsert7xTcf, minCMV, 3xNLS, ONL
UseLuciferaseAvailable SinceJan. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
3582 pcDNA3 Bad S136E
Plasmid#8800DepositorAvailable SinceAug. 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1617 pAAV SYN1 Nuc-EYFP
Plasmid#135567PurposeAn AAV vector expressing a neuronally expressed nuclear EYFP reporterDepositorInsertsempty
Nuc-EYFP
UseAAVTags3xNLSExpressionMammalianPromoterhSYN1Available SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFB-Flag-MyoD
Plasmid#25994DepositorAvailable SinceAug. 20, 2010AvailabilityAcademic Institutions and Nonprofits only -
pSUPER.retro.puro-shMePCE_shLARP7
Plasmid#113538PurposeRetroviral vector designed to knock down MePCE and LARP7 simultaneously.DepositorInsertshMePCE and shLARP7 (MEPCE Human)
UseRetroviralAvailable SinceJuly 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-Ef1a-mCh-Puro-Luci
Plasmid#31850DepositorInsertLuciferase RNAi
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianPromoterU6 for shRNA; Ef1alpha for mCherry-puromycinAvailable SinceJan. 3, 2012AvailabilityAcademic Institutions and Nonprofits only -
pGL3-24p3/LCN2-282kB mut-LUC
Plasmid#46867Purposemurine 24p3 minimal promoter with NF-kB mutation as a luciferase reporterDepositorInsert24p3/lipocalin 2 proximal promoter
UseLuciferaseMutationNF- kB site is mutated (see comments)Promoter24p3 promoter (inactive)Available SinceSept. 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGL3-24p3/LCN2-282C/EBP mut-LUC
Plasmid#46868Purposemurine 24p3 minimal promoter with C/EBP mutation k as a luciferase reporterDepositorInsert24p3/lipocalin 2 proximal promoter
UseLuciferaseMutationCEBP site is mutated (see comments)Promoter24p3 promoter (inactive)Available SinceSept. 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
pTYB3-human PUM1-HD MUT3-2 (C935S-Q939E)-intein-CBD
Plasmid#73302PurposeExpresses mutant human PUM1-HDDepositorInserthuman PUM1 Pumilio homology domain (PUM1 Human)
TagsinteinExpressionBacterialMutationC935S-Q939EAvailable SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-GFP-LplA(AAG)
Plasmid#61820PurposeContains GFP tag for direct live-cell fluorescence imaging of the resofurin ligaseDepositorInsertE. coli lipoic acid ligase
TagsGFPExpressionMammalianMutationE20A, F147A, H149GPromoterCMVAvailable SinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
HOXB7 (human) HIS-tag pET
Plasmid#8538DepositorAvailable SinceMay 30, 2006AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 PARL-FLAG-CT S65A+T69A+S70A
Plasmid#13616DepositorTagsFLAGExpressionMammalianMutationchanged Ser 65, Thr 69 and Ser 70 to AlanineAvailable SinceJan. 12, 2007AvailabilityAcademic Institutions and Nonprofits only -
pRB113.2
Plasmid#181948PurposeaTc-inducible expression of NarL with C-terminal mNeonGreen fusion. Also contains mCherry under NarL-controlled promoter PdcuSDepositorInsertTagsmNeonGreenExpressionBacterialPromoterNarL-mNG-PLtetO-1; mCherry-PdcuS; tetR-J23106Available SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRShygro shID3#1
Plasmid#19164DepositorInsertsmall hairpin RNA against inhibitor of DNA binding 3 (ID3 Human)
UseRNAi and RetroviralExpressionMammalianAvailable SinceSept. 16, 2008AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-Map7-Start-1351
Plasmid#46075DepositorAvailable SinceJuly 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCI syn iGluf
Plasmid#106121PurposeFast indicator for synaptic glutamate imaging (synapsin promoter)DepositorInsertiGluSnFR E25D variant
TagsMyc and PDGFRExpressionMammalianMutationChanged Glu 25 to AspPromotersynapsinAvailable SinceJune 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCru5-/UAA-mEGFP-IRES-mCherry
Plasmid#49225PurposeRetroviral expression vector. Contains an altered Kozak sequence and/or upstream open reading frames to modulate expression at the level of translation.DepositorInsertsmEGFP
mCherry
UseRetroviral and Synthetic BiologyTagsSfuI site to create C-terminal fusionsExpressionMammalianPromoterViral LTR (or CMV)Available SinceDec. 5, 2013AvailabilityAcademic Institutions and Nonprofits only