We narrowed to 16,546 results for: OMP;
-
Plasmid#105780PurposeExpression of your protein of interest in fusion with red fluorescent protein at the N-terminus (cleavable by TEV), (PMID: 26879144). mRuby3 is brighter than mCherry and has shifted ex and em spectra.DepositorTypeEmpty backboneUseFlp-in competentTagsmRuby3-TEVExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only
-
p3E-mTagBFP-CAAX
Plasmid#75176PurposeMembrane targeted TagBFP (blue) fluorophore with stop codon for C-terminal fusionsDepositorInsertmTagBFP-CAAX
UseThree prime entry vector for multisite gateway th…Promotern/aAvailable SinceOct. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTS101 pHAGE2 CMVtetO2 TagBFP-P2A-ALFA-22xGS-SUMOEu-MCS
Plasmid#199354PurposeLentiviral transfer plasmid for doxycycline inducible expression of a N-terminally BFP-P2A-ALFA-SUMOEu-tagged protein in mammalian cells.DepositorTypeEmpty backboneUseLentiviralTagsTagBFP-P2A-ALFA-SUMOEuExpressionMammalianMutationWTAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET28 MBP NAAEF-AMPKa1 (13-476,529-550)-b2(76-272)-g1(24-327)
Plasmid#177850PurposeBacterial Expression of AMPKDepositorInsertAMPK (a1b2g1)
TagsMBPExpressionBacterialAvailable SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHEA
Plasmid#168297PurposeBacterial surface display of polypeptides (nanobodies) in E. coliDepositorInsertEnterohemorraghic E. coli autotransporter EhaA C-terminal fragment (C-EhaA)
Tags6xHis, E-tag, and PelB signal peptideExpressionBacterialPromoterLacI-PlacAvailable SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLX302 MX1-V5 puro
Plasmid#158640PurposeLentiviral expression vector for constitutive expression of V5-tagged MX1.DepositorAvailable SinceOct. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET-DUET-1-mRhubarb713-HO
Plasmid#141199PurposeExpresses mRhubarb713 fluorescent protein and heme oxygenaseDepositorInsertsmRhubarb713
heme oxygenase
Tags6x-HisExpressionBacterialMutationR134H, W309R, Q310A compared to iRFPPromoterT7Available SinceSept. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR207 SARS-CoV-2 M_nostop
Plasmid#149322PurposeGateway-compatible Entry vector, with insert of the membrane (M) gene's CDS from SARS-CoV-2 isolate Wuhan-Hu-1. Does not contain stop codon.DepositorInsertM (M SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway CloningMutationMany synonymous changes due to codon optimizationAvailable SinceMay 6, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
TK-GFP-Nluc-P2A-neo-TK
Plasmid#134896PurposeExpresses GFP protein and a fusion protein of Nluc-neo inserting into Cryptosporidium parvum TK locusDepositorInsertTK-GFP-Nluc-P2A-Neo-TK
UseCryptosporidium expressionPromoterCryptosporidium actin and enolaseAvailable SinceNov. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pIZ-Flag6His-Siwi
Plasmid#50560PurposeExpresses FLAG, His tagged Siwi in silkworm cell line BmN4 or insect cellsDepositorAvailable SinceMarch 31, 2014AvailabilityAcademic Institutions and Nonprofits only -
pIC306
Plasmid#52257PurposeRetroviral expression of EGFP-TEV-S-tag SKA3 for protein localization and affinity purification (LAP)DepositorInsertSka3 (SKA3 Human)
UseRetroviralTagsEGFP, S tag, and TEV protease siteExpressionMammalianAvailable SinceMarch 31, 2014AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-ST1
Plasmid#48678PurposeMammalian tdTomato activation reporter for ST1 with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, ST1-PAM, and tdTomato reporter. Compatible with S. thermophilus #1 Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
Flag Nprl2 pLJM1
Plasmid#46338DepositorAvailable SinceJuly 15, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-ICUE4
Plasmid#181846PurposeFourth-generation FRET-based Indicator of cAMP Using Epac. Genetically encoded cAMP indicator. Contains high-sensitivity Epac Q270E mutation.DepositorInsertICUE4 (RAPGEF3 Human)
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianMutationGlutamine 122 in Epac1 domain mutated to glutamat…PromoterCMVAvailable SinceJune 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
loxP-Hygro-loxP-HA-mStayGold-Rab11 HR
Plasmid#229678PurposeHomology repair plasmid for endogenous tagging of Rab11 at the N-terminus with monomeric StayGold and an HA epitope tag. Contains a hygromycin resistance cassette for selection of edited cellsDepositorAvailable SinceJan. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDEST40-MFRN2
Plasmid#50546PurposeExpression of MFRN2 gene in mammalian cellsDepositorAvailable SinceJan. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
mCRISPRi-v2, Gene Expression (m5), top 5 sgRNAs/gene
Pooled Library#83993PurposeMouse CRISPRi Pooled Library targeting gene expressionDepositorAvailable SinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 SARS-CoV-2 ORF3B_nostop
Plasmid#149320PurposeGateway-compatible Entry vector, with insert of ORF3B gene's CDS from SARS-CoV-2 isolate Wuhan-Hu-1. Does not contain stop codon.DepositorInsertORF3B
UseGateway CloningMutationMany synonymous changes due to codon optimizationAvailable SinceMay 6, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pENTR221-IL6.Pro
Plasmid#79491PurposeMultiSite Gateway entry clones, first fragment, (attL1, attR5) Human IL6 promoterDepositorAvailable SinceMay 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSplit-CO-hDib1
Plasmid#58788PurposeExpress LucC-hDib1 fusion protein in mammalian cellsDepositorAvailable SinceAug. 15, 2014AvailabilityAcademic Institutions and Nonprofits only