We narrowed to 3,302 results for: grna design
-
Plasmid#102689PurposeS. pombe gRNA entry vector with Cas9 - Sp his3 markerDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceApril 5, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pYZ293
Plasmid#102687PurposeS. pombe gRNA entry vector with Cas9 - Sp leu1 markerDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceApril 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYZ292
Plasmid#102686PurposeS. pombe gRNA entry vector with Cas9 - ScLEU2 markerDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceApril 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBW1997_pExpr-hU6-CRISPR-DECODER
Plasmid#87549PurposeExpresses NGN2, MIAT, ACTC1, and TTN gRNAs in response to combinations of Cre and Flp recombinasesDepositorInsertgRNAs targeting NGN2, MIAT, ACTC1, TTN
UseCRISPR, Cre/Lox, and Synthetic BiologyExpressionMammalianAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDECKO-mCherry GFP
Plasmid#78535PurposeControl plasmid (paired gRNAs against GFP)DepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralExpressionMammalianPromoterU6 (for expressing sgRNA) and U6 promoterAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
UC20m
Plasmid#121040PurposeMoClo golden gate assembly DE part for gN2 gRNA (guide RNA for S. pyogenes Cas9; sequence designed with NUPACK for stable tracrRNA structure and open targeting region).DepositorInsertgN2 Cas9 gRNA UC part
UseSynthetic BiologyAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_mCherry
Plasmid#78534PurposeBackbone to clone single or paired sgRNAsDepositorTypeEmpty backboneUseLentiviralExpressionMammalianPromoterU6 (for expressing sgRNA)Available SinceJuly 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
CROP-seq-opti
Plasmid#106280PurposeA version of the CROP-seq plasmid as presented in Datlinger et al. that contains the sgRNA-(F+E)-combined optimized backbone for CRISPRi from Chen et al.DepositorInsertEF1a-Puro-WPRE-hU6-gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceMarch 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDECKO-mCherry MALAT1_Enhancer.1
Plasmid#78536PurposeExperimental plasmidDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralExpressionMammalianPromoterU6 (for expressing sgRNA) and U6 promoterAvailable SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDECKO-mCherry MALAT1_Exon.1
Plasmid#78540PurposeExperimental plasmidDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralExpressionMammalianPromoterU6 and U6 (for expressing sgRNA)Available SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDECKO-mCherry TFRC_B
Plasmid#78544PurposeExperimental plasmidDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralExpressionMammalianPromoterU6 and U6 (for expressing sgRNA)Available SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDECKO-mCherry MALAT1_Exon.2
Plasmid#78541PurposeExperimental plasmidDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralExpressionMammalianPromoterU6 (for expressing sgRNA) and U6 promoterAvailable SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDECKO-mCherry MALAT1_Exon.4
Plasmid#78543PurposeExperimental plasmidDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralExpressionMammalianPromoterU6 and U6 (for expressing sgRNA)Available SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDECKO-mCherry MALAT1_Enhancer.4
Plasmid#78539PurposeExperimental plasmidDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralExpressionMammalianPromoterU6 and U6 (for expressing sgRNA)Available SinceAug. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDECKO-mCherry MALAT1_Enhancer.3
Plasmid#78538PurposeExperimental plasmidDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralExpressionMammalianPromoterU6 and U6 (for expressing sgRNA)Available SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only