We narrowed to 1,566 results for: aav vector plasmid
-
Plasmid#113039PurposeAAV vector; encodes GFP as well as a U6-driven gRNA scaffold (SpyCas9)DepositorInsert2x BbsI sites - SpCas9 scaffold, co-expressed GFP (transfection marker)
UseAAVExpressionMammalianAvailable SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(SapI)-CMV-intron-MCS-pA
Plasmid#192496PurposeTo express CasRX gRNA and contains MCS to insert coding region of interestDepositorInsertCasRx
UseAAVMutationNoPromoterCMVAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.T7-SP6-BC(p11-14)-minBG-CI-mRuby2-W3SL-T7
Plasmid#231353PurposeSingle stranded AAV genome with barcodeless T7 RNA polymerase promoter and SP6-driven barcode, for tracking AAV concatemers via SpECTr. Also expresses mRuby2 from minBG promoter.DepositorInsertT7-SP6-BC(p11-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.T7-SP6-BC(p11-14)-SCP1-tdTomato-W3SL-T7
Plasmid#231356PurposeSingle stranded AAV genome with barcodeless T7 RNA polymerase promoter and SP6-driven barcode, for tracking AAV concatemers via SpECTr. Also expresses tdTomato from SCP1 promoter.DepositorInsertT7-SP6-BC(p11-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.T7-SP6-BC(p11-14)-CMVp-CI-mRuby2-W3SL-T7
Plasmid#231357PurposeSingle stranded AAV genome with barcodeless T7 RNA polymerase promoter and SP6-driven barcode, for tracking AAV concatemers via SpECTr. Also expresses mRuby2 from CMV promoter.DepositorInsertT7-SP6-BC(p11-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.T7-SP6-BC(p11-14)-Ef1s-CI-mRuby2-W3SL-T7
Plasmid#231358PurposeSingle stranded AAV genome with barcodeless T7 RNA polymerase promoter and SP6-driven barcode, for tracking AAV concatemers via SpECTr. Also expresses mRuby2 from Ef1s promoter.DepositorInsertT7-SP6-BC(p11-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.T7-SP6-BC(p11-14)-SCP1-CI-mRuby2-W3SL-T7
Plasmid#231359PurposeSingle stranded AAV genome with barcodeless T7 RNA polymerase promoter and SP6-driven barcode, for tracking AAV concatemers via SpECTr. Also expresses mRuby2 from SCP1 promoter.DepositorInsertT7-SP6-BC(p11-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.T7-SP6-BC(p11-14)-CAG-EGFP-W3SL-T7
Plasmid#231348PurposeSingle stranded AAV genome with barcodeless T7 RNA polymerase promoter and SP6-driven barcode, for tracking AAV concatemers via SpECTr. Also expresses EGFP from CAG promoter.DepositorInsertT7-SP6-BC(p11-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAVf-EnhCB-lacZnls mir-122 1xBS
Plasmid#35643DepositorInsert1 miR-122 target site
UseAAVPromoterCBAvailable SinceApril 25, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SynI-CreOn-FlpOff-TeNT-P2A-EGFP
Plasmid#176282PurposeViral vector for co-expression of TeNT and EGFP in cells expressing Cre AND NOT Flp driven by the human Synapsin promoter.DepositorInsertTeNT-P2A-EGFP
UseAAV and Cre/LoxExpressionMammalianPromoterhuman Synapsin IAvailable SinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV CMV-driven AcrIIC3-scaffold (2xBsmBI sites)
Plasmid#120301PurposeAAV vector for expression of AcrIIC3 (no miR binding sites, control vector)DepositorInsertAcrIIC3
UseAAV and CRISPRExpressionMammalianAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV CMV-driven AcrIIC1-scaffold (2xBsmBI sites)
Plasmid#120300PurposeAAV vector for expression of AcrIIC1 (no miR binding sites, control vector)DepositorInsertAcrIIC1
UseAAV and CRISPRExpressionMammalianAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-G88P3-HA-hM3Dq
Plasmid#213972PurposeAAV vector with G88P3 promoter that can drive robust gene expression in MSNsDepositorInserthM3D (Gq)
UseAAVPromoterG88P3Available SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-BDLacZ-SAS620-3'Luciferase (split CAGGT)-SV40pA
Plasmid#216321PurposeSplit luciferase assay to test reconstitution via mRNA trans-splicing (REVeRT system).DepositorInsertSplit Luciferase + splice acceptor site
UseAAVPromoterCMVAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEJS1830 All-in-one AAV-U1a-NmeABE-8e-2xBPSV40-U6-Fah
Plasmid#199263PurposeSingle AAV vector for expressing N-terminal fusion Nme2Cas9-ABE8e and one U6 driven sgRNA targeting the point mutation in the mouse Fah gene of a HT1 mouse modelDepositorInsertNmeABE8e
UseAAV and CRISPRTagsNLSExpressionMammalianPromoterU1aAvailable SinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-flex-ReaChR-citrine
Plasmid#50955Purposeflexed-ReaChR-citrine in AAV2 vector under human synapsin promoterDepositorInsertReaChR-citrine
UseAAVTagscitrinePromoterhuman synapsin promoterAvailable SinceFeb. 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD2-ChR2-mCherry
Plasmid#170845PurposeAAV vector for Cre-dependent transgene expression of ChR2-mCherry in cortical interneurons under the control of the Dlx enhancer.DepositorInsertChR2-mCherry
UseAAVExpressionMammalianPromoterDlxAvailable SinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-P301L Tau
Plasmid#176267PurposeThis AAV plasmid vector expresses human 2N4R microtubule-associated protein tau with P301L mutation.DepositorAvailable SinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1484 - pAAV SYN1 HA-hM4D(Gi)
Plasmid#121538PurposeAn adeno-associated viral vector expressing HA-tagged inhibitory DREADD (hM4D(Gi)) from a synapsin promoterDepositorHas ServiceAAV2 and AAV5InsertHA-tagged hM4D(Gi) (CHRM4 Human)
UseAAVTagsHAExpressionMammalianPromoterSYN1Available SinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1596 - pAAV SYN1 HA-hM3D(Gq)
Plasmid#121539PurposeAn adeno-associated viral vector expressing HA-tagged stimulatory DREADD (hM3D(Gq)) from a synapsin promoterDepositorHas ServiceAAV Retrograde, AAV2, and AAV5InsertHA-tagged hM3D(Gq) (CHRM3 Human)
UseAAVTagsHAExpressionMammalianPromoterSYN1Available SinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-G88P7-rM3Ds-2A-EYFP
Plasmid#213970PurposeAAV vector with G88P7 promoter in order to induce robust expression of rM3Ds in MSNsDepositorInsertrM3Ds
UseAAVPromoterG88P7Available SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.FAPdL5-POST-T2A-dTomato.WPRE.bGH
Plasmid#105981PurposeThis AAV plasmid constitutively expresses an extracellular dL5 FAP fused to the neuroligin-1 cytoplasmic domain for targeting to the synapse with a cell fill dTomato.DepositorInserthSyn-Igkappa-myc-FAPdL5-POST-T2A-dTomato-WPRE-bGH
UseAAVTagsFAPdL5-POST, T2A-dTomato, and mycPromoterhuman synapsin 1Available SinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV_CMV-AcrIIA5_cpGR2(GGS5)-N77
Plasmid#246048PurposeExpression of AcrIIA5-cpGR2 hybrid in mammalian cells; insertion before N77; enables chemogenetic control of SauCas9; contains ITRs for AAV packaging with Rep2DepositorInsertAcrIIA5_cpGR2-N77
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianPromoterCMVAvailable SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_OHu19986C_myc tag
Plasmid#183174Purposeused to make AAV vectors for hsTRPA1 tagged with mycDepositorAvailable SinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pC081: pAAV.CMV.mCherry
Plasmid#205744PurposeAAV vector for expressing CMV-driven mCherry reporter gene.DepositorInsertmCherry
UseAAVExpressionMammalianPromoterCMVAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV2_CAG_oROS-HT_WPRE
Plasmid#216414PurposeEncodes the genetically encoded, chemigenetic fluorescent peroxide sensor oROS-HT in AAV viral vectorsDepositorInsertoROS-HT
UseAAVExpressionMammalianPromoterCAGAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CreLite
Plasmid#131785PurposeAAV donor/transfer vector expressing CreLite system components, PhyBΔCreC and PIF6CreN, driven by CBh promoterDepositorInsertPhyBCreC-P2A-PIF6CreN
UseAAV, Cre/Lox, and Synthetic BiologyExpressionMammalianPromoterCBhAvailable SinceJan. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLY080b_AAV_EFS-4D5-CD8-28BBz (HER2 CAR)
Plasmid#192190PurposeHER2 CAR AAV vector PRODH2 KI (pLY080b)DepositorInsertHER2 CAR AAV vector PRODH2 KI (pLY080b) (ERBB2 Synthetic)
UseAAV; Mammalian expressionMutationNAAvailable SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TNT4-Zfr-P2A-HA-YAP5SA-3xMIR122
Plasmid#223186PurposePlasmid containing the Zfr/YAP5SA/3xMIR122 cassette. Translation of YAP5SA is controlled by splicing modulation of the Zfr specifically in cardiomyocytes by risdiplam in vivo.DepositorUseAAVTagsHA and engineered P2AMutationS61A, S109A, S127A, S164A, S381APromoterTNNT2Available SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CW3SL-EGFP
Plasmid#61463PurposeAAV vector with CaMKIIa promoter, EGFP, and W3SL(shorten expression cassette with relatively high expression to maximize expression of larger genes)DepositorInsertEGFP
UseAAVPromoterCaMKIIaAvailable SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SlugABE-NNG
Plasmid#214356PurposeExpresses SlugABE-NNGDepositorInsertSlugABE-NNG
UseAAVExpressionMammalianMutationQ782R/S888R/L906R/N984S/E1012K/K1016IAvailable SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-Dlx-tTA
Plasmid#210730PurposeAAV vector expressing tetracycline-controlled transactivator (tTA) under Dlx promoter (for expressing tTA in GABAergic neurons)DepositorInserttetracycline-controlled transactivator (tTA)
UseAAVPromoterDlxAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDV24_AAV2_DART-VADAR_iRFP720-sensor
Plasmid#200411PurposeAAV vector encoding a DART-VADAR sensor for iRFP720 mRNADepositorInsertDART VADAR sensor
UseAAV and Synthetic BiologyTagsMCP-ADAR2dd(E488Q)-NES, TagBFP, and mNeonGreenExpressionMammalianPromoterCMVAvailable SinceJune 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-CamK2-tTA
Plasmid#210731PurposeAAV vector expressing tetracycline-controlled transactivator (tTA) under CamK2 promoter (for expressing tTA in glutamatergic neurons)DepositorInserttetracycline-controlled transactivator (tTA)
UseAAVPromoterCamK2Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLP110_AAV Scramble Control
Plasmid#239419PurposeNegative control AAV vector for SaCas9-based CRISPR KODepositorInsertScramble control
UseAAVAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-HGM (optimized)
Plasmid#220988PurposeAdeno-associated viral vector to express HaloTag-GFP-mito fusion, a cytosolic-localized Halotag-GFP fusion constructDepositorInsertHaloTag-GFP-mito
UseAAVAvailable SinceAug. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-EGFP-APOBEC1
Plasmid#209321PurposeAAV packaging vector containing a EGFP-P2A expression cassette, APOBEC1 expression.DepositorInsertAPOBEC1-HA
UseAAVTagsHAAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-hM4D(Gi)-mCherry
Plasmid#44362PurposeDouble floxed Gi-coupled hM4D DREADD fused with mCherry under the control of human synapsin promoter.DepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InserthM4D(Gi)-mCherry
UseAAV; Adeno associated viral vectorTagsmCherryPromoterhuman Synapsin 1Available SinceApril 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-hM3D(Gq)-mCherry
Plasmid#44361PurposeDouble floxed Gq-coupled hM3D DREADD fused with mCherry under the control of human synapsin promoter.DepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InserthM3D(Gq)-mCherry
UseAAV; Adeno associated viral vectorTagsmCherryPromoterhuman Synapsin 1Available SinceMay 10, 2013AvailabilityAcademic Institutions and Nonprofits only