We narrowed to 78,467 results for: rest
-
Plasmid#219572PurposeExpresses MYC-tagged hTRAK1 (S200A, S201A)DepositorInserttrak1 (TRAK1 Human)
TagsMYCExpressionMammalianMutationSerine 200 changed to alanine, serine 201 changed…PromoterCMVAvailable SinceFeb. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgTnr#1/Cre
Plasmid#193244PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Tnr geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pODN-H2BC11-TagBFP
Plasmid#183867PurposeRepair template for the C-terminal tagging of H2B histones with mTagBFP in human cells using CRISPR/Cas9.DepositorInsertH2BC11 homology arms with linker-mTagBFP (H2BC11 Human)
UseCRISPR; Donor templateTagslinker-mTagBFPExpressionMammalianMutationHomology arms contain point mutations to remove t…Available SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
PEA1-Nuclease
Plasmid#176528PurposeDelivers all prime editing nuclease components in a single plasmidDepositorInsertCbH-Cas9-RT, hU6-pegRNA (Bbs1 gate), hU6-sgRNA (Bbs1 gate)
UseCRISPRExpressionMammalianMutationGC to CA point mutation in SpCas9 to restore nucl…PromoterCbH for Cas9, hU6 for gRNAsAvailable SinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA s3
Plasmid#132395PurposeTargets AAVS1 intron 1, gRNA: GGGGCCACTAGGGACAGGAT, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3/ TO myc-cCE-bio (cCE-bio)
Plasmid#82473PurposeExpresses cytoplasmic restricted form of N-terminal myc tagged and C-terminal biotin tagged mRNA capping enzyme, inactive formDepositorInsertMyc-NES-mCE (Wt, NLS deletion)-TEV-Bio (Rngtt Synthetic, Mouse)
TagsTEV-Biotin and mycExpressionMammalianPromoterCMVAvailable SinceSept. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 P676C I730C (NT809)
Plasmid#50866PurposeExpresses human NKCC1 P676C I730C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationP676C I730C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 I674C (NT475)
Plasmid#50875PurposeExpresses human NKCC1 I674C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationI674C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 N680C A734C (NT816)
Plasmid#50870PurposeExpresses human NKCC1 N680C A734C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationN680C A734C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 L737C (NT523)
Plasmid#50891PurposeExpresses human NKCC1 L737C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationL737C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 P676C A734C (NT810)
Plasmid#50867PurposeExpresses human NKCC1 P676C A734C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationP676C A734C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 N672C (NT474)
Plasmid#50873PurposeExpresses human NKCC1 N672C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationN672C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 P676C (NT443)
Plasmid#50877PurposeExpresses human NKCC1 P676C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationP676C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 N731C (NT505)
Plasmid#50885PurposeExpresses human NKCC1 N731C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationN731C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 V673C (NT437)
Plasmid#50874PurposeExpresses human NKCC1 V673C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationV673C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 I677C (NT467)
Plasmid#50878PurposeExpresses human NKCC1 I677C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationI677C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 I678C (NT445)
Plasmid#50879PurposeExpresses human NKCC1 I678C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationI678C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 L736C (NT522)
Plasmid#50890PurposeExpresses human NKCC1 L736C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationL736C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 A675C (NT441)
Plasmid#50876PurposeExpresses human NKCC1 A675C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationA675C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 I730C (NT504)
Plasmid#50884PurposeExpresses human NKCC1 I730C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationI730C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only