We narrowed to 26,162 results for: Tat
-
Plasmid#58891Purposeprovides zebrafish lck promoter (7.4 kb) for GateWay construction of Tol2 transgenesDepositorInsertzebrafish lymphocyte-specific protein tyrosine kinase (lck) promoter, 7.4 kb
UseGateway 5' entry cloneMutationmutated single nucleotide (T-->C, 1874th nucle…Promoterlymphocyte-specific protein tyrosine kinase (lck)…Available SinceAug. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
shHIF2α(#2) (HIF2α-#3-pSUPER-retro-GFP/Neo)
Plasmid#22132DepositorInsertsynthethic oligonucleotide
UseRNAi and RetroviralExpressionMammalianMutationsynthethic oligonucleotide encoding shRNA targeti…Available SinceFeb. 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA2-Keap1 S3H4
Plasmid#21594DepositorInsertkelch-like ECH-associated protein 1 (KEAP1 Human)
TagsHA2ExpressionMammalianMutationMutated residues in the beta-sheet S3 and alpha-h…Available SinceJuly 8, 2009AvailabilityAcademic Institutions and Nonprofits only -
pLminP_Luc2P_RE6
Plasmid#90340PurposeSTAT5 - Stat5 gene reporterDepositorInsertFirefly luciferase
UseLentiviralPromoterSTAT5Available SinceMay 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJW1259
Plasmid#61251PurposeCas9 plasmid with sgRNA deleted; for use in C. elegansDepositorInsertDeletion
UseCRISPRExpressionWormMutationDeleted sgRNA(F+E) sequence from pJW1219Available SinceDec. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
-
p5'Entry-lck-5.5kb
Plasmid#58890Purposeprovides zebrafish lck promoter (5.5 kb) for GateWay construction of Tol2 transgenesDepositorInsertzebrafish lymphocyte-specific protein tyrosine kinase (lck) promoter, 5.5 kb
UseGateway 5' entry cloneMutationmutated single nucleotide (T-->C, 13th nucleot…Promoterlymphocyte-specific protein tyrosine kinase (lck)…Available SinceAug. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
p7SL-neo-TET
Plasmid#51285Purposeexpresses human 7SL RNA, using its own polIII enhancer, and tagged with the self splicing intron neo cassetteDepositorInsert7SL RNA (RN7SL2 Human)
TagsneoTET cassette with a tetrahymena self-splicing …ExpressionMammalianPromoter7SL upstream pollII enhancerAvailable SinceApril 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pET N6his GFP1-9
Plasmid#182240PurposeTripartite split-GFP. E. coli vector. Expression of GFP1-9 detector fragment.DepositorInsertGFP1-9
Tags6HISExpressionBacterialPromoterT7Available SinceApril 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
3265 pBS Mcl-1
Plasmid#8763DepositorInsertMcl-1 (Mcl1 Mouse)
UseCloning vectorAvailable SinceNov. 2, 2005AvailabilityAcademic Institutions and Nonprofits only -
pCF806-shRen.713
Plasmid#186712PurposeExpresses dox-controlled miR-E shRNAs (UT4GEPIR). Non-targeting control shRNA (shRen.713).DepositorInsertshRen.713
UseLentiviral and RNAiExpressionMammalianAvailable SinceJuly 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pECE M2-SH3PXD2A WT
Plasmid#69813PurposeExpresses M2-SH3PXD2A in mammalian cellsDepositorInsertSH3 and PX domain-containing protein 2A (SH3PXD2A Human)
TagsFLAGExpressionMammalianPromoterSV40 early promoterAvailable SinceMay 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pClneoMyc human NDR1
Plasmid#37023DepositorAvailable SinceMay 23, 2012AvailabilityAcademic Institutions and Nonprofits only -
GAL4-mNFAT1(2-144)
Plasmid#11108PurposeExpresses mouse NFAT1 (amino acids 2-144) fused to GAL4 DNA binding domain in mammalian cellsDepositorInsertNFAT1 (Nfatc2 Mouse)
TagsGAL4-DBDExpressionMammalianMutationContains NFAT1 amino acids 2-144; L78P and P140Q …Available SinceApril 24, 2006AvailabilityAcademic Institutions and Nonprofits only -
PGKp-GFP-YAP (5SA)
Plasmid#174174PurposeLentiviral vector to constitutively express overactive YAP (5 LATS phosporylation sites mutated to Ala) under control of the human PGK promoter.DepositorInsertYAP (YAP1 Human)
UseLentiviralTags3x FLAG tagExpressionMammalianMutationFive LATS phosphorylation sites (S61, S109, S127,…PromoterPGKAvailable SinceAug. 19, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCMV-PARP1-3xFlag-7xKQ
Plasmid#111576PurposeExpresses full length PARP1 with K to Q mutations in automodification domain in mammalian cellsDepositorInsertPARP1 (PARP1 Human)
Tags3xFlagExpressionMammalianMutationlysine to glutamine mutation at the following ami…PromoterCMVAvailable SinceJuly 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMV306DIG13+FFlucRT
Plasmid#49998PurposeIntegrase removed to increase stability of the plasmid in mycobacteriaDepositorInsertG13 promoter + Firefly luciferase Red Thermostable
UseMycobacteria integrating vectorExpressionBacterialMutationCodon optimized for Mycobacterium tuberculosis wi…PromoterG13Available SinceMay 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJZC48
Plasmid#62336PurposesgRNA + 1x COM with COM-VP64 effector for mammalian cellsDepositorInsertssgRNA + 1x COM binding module
COM-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-hGTB
Plasmid#26196DepositorInsertTet transactivator, enhanced green fluorescent protein, TVA, rabies B19 glycoprotein
UseAAV and Cre/Lox; Adeno-associated virusMutationF2A has 2A cleavage site deleted, producing htTA-…Available SinceNov. 29, 2010AvailabilityAcademic Institutions and Nonprofits only -
pAC-VIOL
Plasmid#53087PurposeProduces the carotenoid violaxanthin in E. coli.DepositorInsertzep (ABA1 Mustard Weed)
UseLow copy number bacterial cloning vectorMutationLacks codons for the first 60 N-terminal amino ac…PromoterT7Available SinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only