We narrowed to 5,521 results for: crispr cas9 grna plasmid
-
Plasmid#155074PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_MDM4_exon_deletion_4
Plasmid#155076PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_1_As
Plasmid#155057PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_SFRS7_exon_deletion_4
Plasmid#155072PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_PDPR_exon_deletion_3
Plasmid#155067PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_PDPR_exon_deletion_4
Plasmid#155068PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_2_As
Plasmid#155058PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon2_2_As
Plasmid#155056PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon2_1_As
Plasmid#155055PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon2_2_Lb
Plasmid#155052PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTE4398
Plasmid#74042PurposeExpresses human codon-optimized LbCpf1 and Lb crRNA.DepositorInsertsLb crRNA
LbCpf1
UseCRISPRTags3xHA and NLSExpressionMammalianPromoterCMV and human U6Available SinceApril 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
piCRg Entry
Plasmid#58904PurposeCas9/gRNA Entry expression plasmidDepositorInserthSpCas9
ExpressionMammalianAvailable SinceSept. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLY86
Plasmid#130949PurposeEngineered sgRNA-LEA2-WTmis2 generator circuit including promoter Plux2, 2 BoxB aptamers and 2 mis-matches in sgRNA scaffoldDepositorInsertsgRNA-LEA2-WTmis2
UseSynthetic BiologyExpressionBacterialPromoterPlux2Available SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pgTS40
Plasmid#169630PurposepX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.DepositorInsertU6-driven gRNA expression and PCAG-driven SpCas9 expression
ExpressionMammalianPromoterU6 / PCAGAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLP16_Lenti Scramble Control
Plasmid#239417PurposeNegative control Lentiviral plasmid for SpCas9-based CRISPR KODepositorInsertScramble sequence
UseLentiviralAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330-TJP1
Plasmid#227299PurposeExpresses SpCas9 and a sgRNA targeting the N-terminus of TJP1 for knock-in.DepositorAvailable SinceNov. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX458-PLK4
Plasmid#227310PurposeExpresses SpCas9 and a sgRNA targeting the C-terminus of PLK4 for knock-in.DepositorAvailable SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAID-EF1a linearizing in pX330
Plasmid#140610PurposeCrispr/Cas9 plasmid for linearization of pAID-EF1aDepositorInsertsgRNA for pAID-EF1a plasmid digestion
UseCRISPRAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAID-CMV linearizing in pX330
Plasmid#140609PurposeCrispr/Cas9 plasmid for linearization of pAID-CMVDepositorInsertsgRNA for pAID-EF1a plasmid digestion
UseCRISPRAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291D
Plasmid#115200PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291D into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291D (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S293D
Plasmid#115201PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S293D into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S293D (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291D/S293D
Plasmid#115202PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291D/S293D into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291D/S293D (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRISP_IS
Plasmid#120425PurposeThis plasmid encodes the complete CRISPR/dCas9 machinery for repressing transposition of the following bacterial Insertion Sequences: IS1, IS3 and IS5.DepositorInsertCRISPR spacers targeting IS1, IS5, IS3
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterconstitutiveAvailable SinceJan. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCut plasmid toolkit
Plasmid Kit#1000000118PurposePlasmids for integrating into well-characterized chromosomal loci to program gene expression in S. cerevisiae.DepositorApplicationGenome EditingVector TypeYeast ExpressionEditing TypeCRISPRAvailable SinceAug. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
px458-AMBRA1 (optimized for N-terminal knock-in)
Plasmid#172608PurposeExpresses a gRNA against AMBRA1 and Cas9 from S. pyogenes with 2A-EGFP. This gRNA is suitable for the N-terminal knock-in of AMBRA1.DepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330-PCNT
Plasmid#227284PurposeExpresses SpCas9 and a sgRNA targeting the N-terminus of PCNT for knock-in.DepositorAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiSAM v2 (Puro)
Plasmid#92062PurposeModified version of lentiSAM v2, a lenti sgRNA cloning backbone with MS2 loops at tetraloop/stemloop 2, dCas9-VP64, and puro resistance marker. Contains BsmBI sites for insertion of spacer sequences.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 (sgRNA) and EF1a (dCas9-VP64)Available SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pY108 (lenti-AsCpf1)
Plasmid#84739PurposeLenti virus delivery of AsCpf1 and crRNA guideDepositorInsertshuAsCpf1
puromycin resistance gene
UseLentiviralTags3xHA, NLS, and P2APromoterEFSAvailable SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pY109 (lenti-LbCpf1)
Plasmid#84740PurposeLenti virus delivery of LbCpf1 and crRNA guideDepositorInsertshuLbCpf1
puromycin resistance gene
UseLentiviralTags3xHA, NLS, and P2APromoterEFSAvailable SinceNov. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pY094
Plasmid#84743PurposeExpresses huAsCpf1-T2A-GFP and crRNA guideDepositorInsertshuAsCpf1
GFP
Tags3xHA, NLS, and T2AExpressionMammalianPromoterCMVAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only