We narrowed to 165,741 results for: DES
-
Plasmid#120288PurposeProduce human recombinant TGFB3 in DE3 cellsDepositorInsertTransforming Growth Factor-β3 (TGFB3 Synthetic, Human)
Tags6x His and S-TagExpressionBacterialMutationCodon optimized for E. Coli productionPromoterT7 promoterAvailable SinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE puro PPAR gamma 2
Plasmid#8859DepositorAvailable SinceMay 28, 2009AvailabilityAcademic Institutions and Nonprofits only -
pMXs-hs-EGR1
Plasmid#52724Purposeretroviral expression of human EGR1DepositorAvailable SinceJune 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSynSRE-T-Luc
Plasmid#60444PurposeUses the hamster HMG-CoA synthase promoter sequence (-324/-225) and minimal HMG-CoA sythnase TATA box (-28/+39) to study SREBP-dependent transcriptional activation.DepositorInsertHMG-CoA synthase promoter (-324/-225)
UseLuciferaseTagsLuciferaseExpressionMammalianPromoterHMG-CoA synthase (-324/-225) & TATAA (-28/+39)Available SinceFeb. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-TLR targeting vector
Plasmid#64215PurposeTargeting vector for the human AAVS1 locus for insertion of traffic light reporter (TLR) constructDepositorInserttraffic light reporter (TLR) (AAVS1 Human)
UseHuman targetingMutationsee publication for detailsPromoterCAGAvailable SinceJuly 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
1319 pcDNA3 flag FKHRL1 AAA
Plasmid#10709DepositorInsertFKHRL1 AAA (FOXO3 Human)
TagsflagExpressionMammalianMutationAAA mutant (see map) - T32A, S253A, S315AAvailable SinceNov. 2, 2005AvailabilityAcademic Institutions and Nonprofits only -
shp63alpha pLKO.1 puro
Plasmid#19120DepositorInsertsmall hairpin RNA against tumor protein p63 (TP63 Human)
UseLentiviral and RNAiExpressionMammalianAvailable SinceSept. 9, 2008AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-K-RAS V12
Plasmid#31200PurposeGateway donor vector containing KRAS G12V.DepositorAvailable SinceJune 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP7b-WPRE (AAV1)
Viral Prep#104489-AAV1PurposeReady-to-use AAV1 particles produced from pGP-AAV-syn-jGCaMP7b-WPRE (#104489). In addition to the viral particles, you will also receive purified pGP-AAV-syn-jGCaMP7b-WPRE plasmid DNA. Syn-driven jGCaMP7b calcium sensor. jGCaMP7b exhibits the brightest resting fluorescence of the jGCaMP7 variants, and can be used for imaging of small neuronal processes. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-FLEX-jGCaMP7s-WPRE (AAV Retrograde)
Viral Prep#104491-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pGP-AAV-syn-FLEX-jGCaMP7s-WPRE (#104491). In addition to the viral particles, you will also receive purified pGP-AAV-syn-FLEX-jGCaMP7s-WPRE plasmid DNA. Synapsin-driven, Cre-dependent, GCaMP7s calcium sensor. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSin Helper
Plasmid#127694PurposePlasmid contains the Sindbis glycoprotein genes and can be converted to mRNA for initiating Sindbis virus packaging. See Resource Information section for annotated plasmid sequence.DepositorInsertSindbis Glycoproteins
UseSynthetic BiologyAvailable SinceJuly 3, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pET_RTX
Plasmid#102787PurposeExpresses the Reverse Transcriptase geneDepositorInsertreverse transcription xenopolymerase
ExpressionBacterialPromoterT7 promoter + lac operatorAvailable SinceJuly 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET-GST
Plasmid#42049DepositorInsertGST
TagsHisExpressionBacterialAvailable SinceMarch 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMA7CR_2.0
Plasmid#73950PurposepMA7CR_2.0 contains arabinose inducible λ/RED β-protein and dam, and aTc inducible CRISPR/Cas9 and recXDepositorInsertscas9
lambda beta
dam
recX
ExpressionBacterialPromoterpAra and pTetAvailable SinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
mCherry-Rab5a-7
Plasmid#55126PurposeLocalization: Ras GTPase, Excitation: 587, Emission: 610DepositorInsertRab5a
TagsmCherryExpressionMammalianPromoterCMVAvailable SinceSept. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-Scrambled
Plasmid#136035PurposeScrambled shRNA (negative control) inserted into the PLKO.1 plasmid (CCTAAGGTTAAGTCGCCCTCG)DepositorInsertNone (Scrambled)
UseLentiviralExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
GolgiCFP
Plasmid#14873DepositorInsertCFP
TagseNOS(1-35)ExpressionMammalianAvailable SinceAug. 9, 2007AvailabilityAcademic Institutions and Nonprofits only -
pCFJ420 - Peft-3::GFP::H2B (ubiquitous)
Plasmid#34877DepositorInsertPeft-3 GFP H2B tbb-2 UTR
UseWorm targetingMutationS65CPromotereef-1A.1 (eft-3)Available SinceFeb. 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
v3em-Cterm-PE2max-∆RNaseH-dualU6
Plasmid#198735PurposeAAV genome encoding C-terminal PE2max and U6 expression cassettesDepositorInsertNpuC-CtermPE2max∆RNaseH
UseAAVPromoterCbhAvailable SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSOUP
Plasmid#165419PurposeThe pSOUP helper plasmid needed for replication of all pGreen (Hellens et al., 2000) based vectors in AgrobacteriumInsertRep A
UseHelper plasmid required for replication for all p…Available SinceApril 26, 2021AvailabilityAcademic Institutions and Nonprofits only